Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LS483332 Streptococcus pyogenes strain NCTC12696 chromosome 1 3 crisprs DinG,csm6,cas9,cas1,cas2,csn2,cas3,DEDDh,csa3 0 1 9 0

Results visualization

1. NZ_LS483332
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LS483332_1 779973-780067 TypeII II-A
1 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LS483332_2 858735-858824 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LS483332_3 958764-958865 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LS483332_1 1.1|780002|37|NZ_LS483332|CRISPRCasFinder 780002-780038 37 MK448944 Streptococcus phage Javan452, complete genome 12345-12381 7 0.811
NZ_LS483332_1 1.1|780002|37|NZ_LS483332|CRISPRCasFinder 780002-780038 37 MK448672 Streptococcus phage Javan117, complete genome 7926-7962 7 0.811
NZ_LS483332_1 1.1|780002|37|NZ_LS483332|CRISPRCasFinder 780002-780038 37 MK448849 Streptococcus phage Javan128, complete genome 7830-7866 7 0.811
NZ_LS483332_1 1.1|780002|37|NZ_LS483332|CRISPRCasFinder 780002-780038 37 MK448850 Streptococcus phage Javan132, complete genome 12655-12691 7 0.811
NZ_LS483332_1 1.1|780002|37|NZ_LS483332|CRISPRCasFinder 780002-780038 37 MK448675 Streptococcus phage Javan129, complete genome 12135-12171 7 0.811
NZ_LS483332_1 1.1|780002|37|NZ_LS483332|CRISPRCasFinder 780002-780038 37 MK448673 Streptococcus phage Javan119, complete genome 11431-11467 7 0.811
NZ_LS483332_1 1.1|780002|37|NZ_LS483332|CRISPRCasFinder 780002-780038 37 MK448845 Streptococcus phage Javan118, complete genome 9809-9845 8 0.784
NZ_LS483332_1 1.1|780002|37|NZ_LS483332|CRISPRCasFinder 780002-780038 37 MK449010 Streptococcus phage Javan90, complete genome 10515-10551 9 0.757
NZ_LS483332_1 1.1|780002|37|NZ_LS483332|CRISPRCasFinder 780002-780038 37 MK448833 Streptococcus phage Javan87, complete genome 10515-10551 9 0.757

1. spacer 1.1|780002|37|NZ_LS483332|CRISPRCasFinder matches to MK448944 (Streptococcus phage Javan452, complete genome) position: , mismatch: 7, identity: 0.811

ccaaaaccactagacatctcaacatctggaacgggat	CRISPR spacer
gttttatcgctagacatctcaacatctggaacgggat	Protospacer
 .   *.*.****************************

2. spacer 1.1|780002|37|NZ_LS483332|CRISPRCasFinder matches to MK448672 (Streptococcus phage Javan117, complete genome) position: , mismatch: 7, identity: 0.811

ccaaaaccactagacatctcaacatctggaacgggat	CRISPR spacer
gttttatcgctagacatctcaacatctggaacgggat	Protospacer
 .   *.*.****************************

3. spacer 1.1|780002|37|NZ_LS483332|CRISPRCasFinder matches to MK448849 (Streptococcus phage Javan128, complete genome) position: , mismatch: 7, identity: 0.811

ccaaaaccactagacatctcaacatctggaacgggat	CRISPR spacer
gttttatcgctagacatctcaacatctggaacgggat	Protospacer
 .   *.*.****************************

4. spacer 1.1|780002|37|NZ_LS483332|CRISPRCasFinder matches to MK448850 (Streptococcus phage Javan132, complete genome) position: , mismatch: 7, identity: 0.811

ccaaaaccactagacatctcaacatctggaacgggat	CRISPR spacer
gttttatcgctagacatctcaacatctggaacgggat	Protospacer
 .   *.*.****************************

5. spacer 1.1|780002|37|NZ_LS483332|CRISPRCasFinder matches to MK448675 (Streptococcus phage Javan129, complete genome) position: , mismatch: 7, identity: 0.811

ccaaaaccactagacatctcaacatctggaacgggat	CRISPR spacer
gtattatcactagacatctcaacatctggaacaggtt	Protospacer
 .*  *.*************************.** *

6. spacer 1.1|780002|37|NZ_LS483332|CRISPRCasFinder matches to MK448673 (Streptococcus phage Javan119, complete genome) position: , mismatch: 7, identity: 0.811

ccaaaaccactagacatctcaacatctggaacgggat	CRISPR spacer
gtattatcgctagacatttcaacatctggaacgggat	Protospacer
 .*  *.*.********.*******************

7. spacer 1.1|780002|37|NZ_LS483332|CRISPRCasFinder matches to MK448845 (Streptococcus phage Javan118, complete genome) position: , mismatch: 8, identity: 0.784

ccaaaaccactagacatctcaacatctggaacgggat	CRISPR spacer
gtattatcgctagacatttcaacatctggaacgggtt	Protospacer
 .*  *.*.********.***************** *

8. spacer 1.1|780002|37|NZ_LS483332|CRISPRCasFinder matches to MK449010 (Streptococcus phage Javan90, complete genome) position: , mismatch: 9, identity: 0.757

ccaaaaccactagacatctcaacatctggaacgggat	CRISPR spacer
gtattatcgctagacatctcaacatctggtacaggtt	Protospacer
 .*  *.*.******************** **.** *

9. spacer 1.1|780002|37|NZ_LS483332|CRISPRCasFinder matches to MK448833 (Streptococcus phage Javan87, complete genome) position: , mismatch: 9, identity: 0.757

ccaaaaccactagacatctcaacatctggaacgggat	CRISPR spacer
gtattatcgctagacatctcaacatctggtacaggtt	Protospacer
 .*  *.*.******************** **.** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 36636 : 48939 8 Synechococcus_phage(28.57%) NA NA
DBSCAN-SWA_2 326696 : 424170 99 Streptococcus_phage(20.69%) transposase,bacteriocin,tRNA,protease NA
DBSCAN-SWA_3 622263 : 629663 6 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_4 632878 : 697505 60 Bacillus_phage(16.67%) transposase,tRNA,protease NA
DBSCAN-SWA_5 1001494 : 1032833 29 Bacillus_phage(20.0%) integrase,transposase,protease attL 999778:999793|attR 1018627:1018642
DBSCAN-SWA_6 1046844 : 1136147 99 Streptococcus_phage(61.19%) portal,terminase,protease,transposase,integrase,tail,capsid,holin,head,tRNA attL 1089255:1089274|attR 1133520:1133539
DBSCAN-SWA_7 1255874 : 1334982 93 Streptococcus_phage(72.58%) portal,terminase,protease,integrase,tail,holin,bacteriocin,capsid,tRNA attL 1272728:1272743|attR 1318860:1318875
DBSCAN-SWA_8 1488792 : 1540633 79 Streptococcus_phage(30.65%) portal,terminase,integrase,tail,capsid,holin,head attL 1494909:1494924|attR 1545169:1545184
DBSCAN-SWA_9 1763594 : 1783062 24 Streptococcus_phage(64.71%) integrase,holin attL 1766793:1766813|attR 1780363:1780383
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage