1. spacer 3.26|1271570|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MK448881 (Streptococcus phage Javan240, complete genome) position: , mismatch: 0, identity: 1.0
atagcctcaagtccgaacttgccttgatag CRISPR spacer
atagcctcaagtccgaacttgccttgatag Protospacer
******************************
2. spacer 3.8|1271569|31|NZ_LS483341|PILER-CR matches to MK448881 (Streptococcus phage Javan240, complete genome) position: , mismatch: 1, identity: 0.968
catagcctcaagtccgaacttgccttgatag CRISPR spacer
aatagcctcaagtccgaacttgccttgatag Protospacer
******************************
3. spacer 3.31|1271900|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MK448882 (Streptococcus phage Javan242, complete genome) position: , mismatch: 1, identity: 0.967
tctaggaaaaaagtgaacagcgaaggtctt CRISPR spacer
tctaggaagaaagtgaacagcgaaggtctt Protospacer
********.*********************
4. spacer 3.35|1272164|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MK448714 (Streptococcus phage Javan241, complete genome) position: , mismatch: 1, identity: 0.967
tgtatcaagtcaattgacgatgatagcaac CRISPR spacer
tgtatcaagtcaattaacgatgatagcaac Protospacer
***************.**************
5. spacer 3.35|1272164|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MK448383 (Streptococcus satellite phage Javan248, complete genome) position: , mismatch: 1, identity: 0.967
tgtatcaagtcaattgacgatgatagcaac CRISPR spacer
tgtatcaagtcaattgacgatgatcgcaac Protospacer
************************ *****
6. spacer 3.13|1271899|31|NZ_LS483341|PILER-CR matches to MK448882 (Streptococcus phage Javan242, complete genome) position: , mismatch: 2, identity: 0.935
ctctaggaaaaaagtgaacagcgaaggtctt CRISPR spacer
atctaggaagaaagtgaacagcgaaggtctt Protospacer
********.*********************
7. spacer 3.15|1272031|31|NZ_LS483341|PILER-CR matches to MK448714 (Streptococcus phage Javan241, complete genome) position: , mismatch: 2, identity: 0.935
ctttccatatgctccaattgtgacagtgtaa CRISPR spacer
cttgccataagctccaattgtgacagtgtaa Protospacer
*** ***** *********************
8. spacer 3.17|1272163|31|NZ_LS483341|PILER-CR matches to MK448714 (Streptococcus phage Javan241, complete genome) position: , mismatch: 2, identity: 0.935
ctgtatcaagtcaattgacgatgatagcaac CRISPR spacer
ttgtatcaagtcaattaacgatgatagcaac Protospacer
.***************.**************
9. spacer 3.17|1272163|31|NZ_LS483341|PILER-CR matches to MK448383 (Streptococcus satellite phage Javan248, complete genome) position: , mismatch: 2, identity: 0.935
ctgtatcaagtcaattgacgatgatagcaac CRISPR spacer
ttgtatcaagtcaattgacgatgatcgcaac Protospacer
.************************ *****
10. spacer 3.21|1271240|30|NZ_LS483341|CRISPRCasFinder,CRT matches to NC_010945 (Streptococcus phage PH15, complete genome) position: , mismatch: 2, identity: 0.933
acatcgtcaccagcaagcacaatagctttt CRISPR spacer
acatcatcaccagcaagcacaatggctttt Protospacer
*****.*****************.******
11. spacer 3.29|1271768|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MK448882 (Streptococcus phage Javan242, complete genome) position: , mismatch: 2, identity: 0.933
atccaacagatcggcatagtggatactatc CRISPR spacer
atctaacagatcagcatagtggatactatc Protospacer
***.********.*****************
12. spacer 3.33|1272032|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MK448714 (Streptococcus phage Javan241, complete genome) position: , mismatch: 2, identity: 0.933
tttccatatgctccaattgtgacagtgtaa CRISPR spacer
ttgccataagctccaattgtgacagtgtaa Protospacer
** ***** *********************
13. spacer 3.3|1271239|31|NZ_LS483341|PILER-CR matches to NC_010945 (Streptococcus phage PH15, complete genome) position: , mismatch: 3, identity: 0.903
cacatcgtcaccagcaagcacaatagctttt CRISPR spacer
aacatcatcaccagcaagcacaatggctttt Protospacer
*****.*****************.******
14. spacer 3.11|1271767|31|NZ_LS483341|PILER-CR matches to MK448882 (Streptococcus phage Javan242, complete genome) position: , mismatch: 3, identity: 0.903
catccaacagatcggcatagtggatactatc CRISPR spacer
aatctaacagatcagcatagtggatactatc Protospacer
***.********.*****************
15. spacer 1.1|825568|27|NZ_LS483341|CRISPRCasFinder matches to NZ_CP008942 (Candidatus Paracaedibacter acanthamoebae isolate PRA3 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815
cttgactttcatttttgaagtgttaga CRISPR spacer
atacaatttcaattttgaagtgttaga Protospacer
* * ***** ***************
16. spacer 1.1|825568|27|NZ_LS483341|CRISPRCasFinder matches to NZ_KX774387 (Providencia rettgeri strain 30905 plasmid pC131, complete sequence) position: , mismatch: 5, identity: 0.815
cttgactttcatttttgaagtgttaga CRISPR spacer
ttgtactttgatttttgaagtgttaaa Protospacer
.* ***** ***************.*
17. spacer 3.14|1271965|31|NZ_LS483341|PILER-CR matches to MK448671 (Streptococcus phage Javan115, complete genome) position: , mismatch: 5, identity: 0.839
ctataacaagtactaacttaataataatcta CRISPR spacer
ctataacaaatactaatttaataataattac Protospacer
*********.******.***********.
18. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MH937504 (Streptococcus phage CHPC1091, complete genome) position: , mismatch: 5, identity: 0.833
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
taaatttgaaaatgacttctacaaattgcc Protospacer
* . ********************.**.**
19. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to AF020798 (Streptococcus thermophilus bacteriophage lysogeny module, integrase homolog (int), putative host cell surface-exposed lipoprotein, putative metallo-proteinase, repressor, Cro-like regulatory protein, and P1-antirepressor homolog genes, complete cds) position: , mismatch: 5, identity: 0.833
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
taaatttgaaaatgacttctacaaattgcc Protospacer
* . ********************.**.**
20. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to KY705290 (Streptococcus phage P9903, complete genome) position: , mismatch: 5, identity: 0.833
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
taaatttgaaaacgacttctacaaattacc Protospacer
* . ********.***********.*****
21. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to KY705255 (Streptococcus phage P0095, complete genome) position: , mismatch: 5, identity: 0.833
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
taaatttgaaaacgacttctacaaattacc Protospacer
* . ********.***********.*****
22. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MH937459 (Streptococcus phage CHPC595, complete genome) position: , mismatch: 5, identity: 0.833
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
taaatttgaaaacgacttctacaaattacc Protospacer
* . ********.***********.*****
23. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MH937473 (Streptococcus phage CHPC929, complete genome) position: , mismatch: 5, identity: 0.833
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
taaatttgaaaatgacttctacaaattgcc Protospacer
* . ********************.**.**
24. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to NC_000871 (Streptococcus phage Sfi19, complete genome) position: , mismatch: 5, identity: 0.833
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
taaatttgaaaatgacttctacaaattgcc Protospacer
* . ********************.**.**
25. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to KY705289 (Streptococcus phage P9902, complete genome) position: , mismatch: 5, identity: 0.833
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
taaatttgaaaacgacttctacaaattacc Protospacer
* . ********.***********.*****
26. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to KT717083 (Streptococcus phage 73, complete genome) position: , mismatch: 5, identity: 0.833
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
taaatttgaaaacgacttctacaaattacc Protospacer
* . ********.***********.*****
27. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to AF158601 (Streptococcus thermophilus bacteriophage SFi18 lysin, gp111, gp183, gp47, gp54, gp71, gp145, gp69, gp40, gp229, gp157, gp233, putative helicase, gp151, gp271, putative primase, gp143, gp106, gp89, gp57, gp51, gp66, gp192, putative DNA binding protein, gp99, and gp235 genes, complete cds) position: , mismatch: 5, identity: 0.833
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
taaatttgaaaatgacttctacaaattgcc Protospacer
* . ********************.**.**
28. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to NC_002072 (Streptococcus phage DT1, complete genome) position: , mismatch: 5, identity: 0.833
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
taaatttgaaaacgacttctacaaattacc Protospacer
* . ********.***********.*****
29. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to AF085222 (Streptococcus thermophilus bacteriophage DT1, complete genome) position: , mismatch: 5, identity: 0.833
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
taaatttgaaaacgacttctacaaattacc Protospacer
* . ********.***********.*****
30. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to HE861935 (Streptococcus phage TP-J34 complete genome) position: , mismatch: 5, identity: 0.833
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
taaatttgaaaatgacttctacaaattgcc Protospacer
* . ********************.**.**
31. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to AF115102 (Streptococcus thermophilus bacteriophage Sfi19, complete genome) position: , mismatch: 5, identity: 0.833
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
taaatttgaaaatgacttctacaaattgcc Protospacer
* . ********************.**.**
32. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to NC_002214 (Streptococcus thermophilus bacteriophage Sfi11, complete genome) position: , mismatch: 5, identity: 0.833
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
taaatttgaaaatgacttctacaaattgcc Protospacer
* . ********************.**.**
33. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MH892354 (Streptococcus phage SW3, complete genome) position: , mismatch: 5, identity: 0.833
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
taaatttgaaaacgacttctacaaattacc Protospacer
* . ********.***********.*****
34. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MH937508 (Streptococcus phage CHPC1156, complete genome) position: , mismatch: 5, identity: 0.833
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
taaatttgaaaacgacttctacaaattacc Protospacer
* . ********.***********.*****
35. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MH937469 (Streptococcus phage CHPC919, complete genome) position: , mismatch: 5, identity: 0.833
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
taaatttgaaaatgacttctacaaattgcc Protospacer
* . ********************.**.**
36. spacer 3.32|1271966|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MK448671 (Streptococcus phage Javan115, complete genome) position: , mismatch: 5, identity: 0.833
tataacaagtactaacttaataataatcta CRISPR spacer
tataacaaatactaatttaataataattac Protospacer
********.******.***********.
37. spacer 3.5|1271371|31|NZ_LS483341|PILER-CR matches to MF042360 (Pseudomonas phage Phabio, complete genome) position: , mismatch: 6, identity: 0.806
cgaacagcatcccagaatttcttaatcttat CRISPR spacer
cgaacagcatcacagtatttcttaagagttt Protospacer
*********** *** ********* * *
38. spacer 3.6|1271437|31|NZ_LS483341|PILER-CR matches to MH937504 (Streptococcus phage CHPC1091, complete genome) position: , mismatch: 6, identity: 0.806
ctcgttttgaaaatgacttctacaagttacc CRISPR spacer
ttaaatttgaaaatgacttctacaaattgcc Protospacer
.* . ********************.**.**
39. spacer 3.6|1271437|31|NZ_LS483341|PILER-CR matches to AF020798 (Streptococcus thermophilus bacteriophage lysogeny module, integrase homolog (int), putative host cell surface-exposed lipoprotein, putative metallo-proteinase, repressor, Cro-like regulatory protein, and P1-antirepressor homolog genes, complete cds) position: , mismatch: 6, identity: 0.806
ctcgttttgaaaatgacttctacaagttacc CRISPR spacer
ttaaatttgaaaatgacttctacaaattgcc Protospacer
.* . ********************.**.**
40. spacer 3.6|1271437|31|NZ_LS483341|PILER-CR matches to KY705290 (Streptococcus phage P9903, complete genome) position: , mismatch: 6, identity: 0.806
ctcgttttgaaaatgacttctacaagttacc CRISPR spacer
ttaaatttgaaaacgacttctacaaattacc Protospacer
.* . ********.***********.*****
41. spacer 3.6|1271437|31|NZ_LS483341|PILER-CR matches to KY705255 (Streptococcus phage P0095, complete genome) position: , mismatch: 6, identity: 0.806
ctcgttttgaaaatgacttctacaagttacc CRISPR spacer
ttaaatttgaaaacgacttctacaaattacc Protospacer
.* . ********.***********.*****
42. spacer 3.6|1271437|31|NZ_LS483341|PILER-CR matches to MH937459 (Streptococcus phage CHPC595, complete genome) position: , mismatch: 6, identity: 0.806
ctcgttttgaaaatgacttctacaagttacc CRISPR spacer
ttaaatttgaaaacgacttctacaaattacc Protospacer
.* . ********.***********.*****
43. spacer 3.6|1271437|31|NZ_LS483341|PILER-CR matches to MH937473 (Streptococcus phage CHPC929, complete genome) position: , mismatch: 6, identity: 0.806
ctcgttttgaaaatgacttctacaagttacc CRISPR spacer
ttaaatttgaaaatgacttctacaaattgcc Protospacer
.* . ********************.**.**
44. spacer 3.6|1271437|31|NZ_LS483341|PILER-CR matches to NC_000871 (Streptococcus phage Sfi19, complete genome) position: , mismatch: 6, identity: 0.806
ctcgttttgaaaatgacttctacaagttacc CRISPR spacer
ttaaatttgaaaatgacttctacaaattgcc Protospacer
.* . ********************.**.**
45. spacer 3.6|1271437|31|NZ_LS483341|PILER-CR matches to KY705289 (Streptococcus phage P9902, complete genome) position: , mismatch: 6, identity: 0.806
ctcgttttgaaaatgacttctacaagttacc CRISPR spacer
ttaaatttgaaaacgacttctacaaattacc Protospacer
.* . ********.***********.*****
46. spacer 3.6|1271437|31|NZ_LS483341|PILER-CR matches to KT717083 (Streptococcus phage 73, complete genome) position: , mismatch: 6, identity: 0.806
ctcgttttgaaaatgacttctacaagttacc CRISPR spacer
ttaaatttgaaaacgacttctacaaattacc Protospacer
.* . ********.***********.*****
47. spacer 3.6|1271437|31|NZ_LS483341|PILER-CR matches to AF158601 (Streptococcus thermophilus bacteriophage SFi18 lysin, gp111, gp183, gp47, gp54, gp71, gp145, gp69, gp40, gp229, gp157, gp233, putative helicase, gp151, gp271, putative primase, gp143, gp106, gp89, gp57, gp51, gp66, gp192, putative DNA binding protein, gp99, and gp235 genes, complete cds) position: , mismatch: 6, identity: 0.806
ctcgttttgaaaatgacttctacaagttacc CRISPR spacer
ttaaatttgaaaatgacttctacaaattgcc Protospacer
.* . ********************.**.**
48. spacer 3.6|1271437|31|NZ_LS483341|PILER-CR matches to NC_002072 (Streptococcus phage DT1, complete genome) position: , mismatch: 6, identity: 0.806
ctcgttttgaaaatgacttctacaagttacc CRISPR spacer
ttaaatttgaaaacgacttctacaaattacc Protospacer
.* . ********.***********.*****
49. spacer 3.6|1271437|31|NZ_LS483341|PILER-CR matches to AF085222 (Streptococcus thermophilus bacteriophage DT1, complete genome) position: , mismatch: 6, identity: 0.806
ctcgttttgaaaatgacttctacaagttacc CRISPR spacer
ttaaatttgaaaacgacttctacaaattacc Protospacer
.* . ********.***********.*****
50. spacer 3.6|1271437|31|NZ_LS483341|PILER-CR matches to HE861935 (Streptococcus phage TP-J34 complete genome) position: , mismatch: 6, identity: 0.806
ctcgttttgaaaatgacttctacaagttacc CRISPR spacer
ttaaatttgaaaatgacttctacaaattgcc Protospacer
.* . ********************.**.**
51. spacer 3.6|1271437|31|NZ_LS483341|PILER-CR matches to AF115102 (Streptococcus thermophilus bacteriophage Sfi19, complete genome) position: , mismatch: 6, identity: 0.806
ctcgttttgaaaatgacttctacaagttacc CRISPR spacer
ttaaatttgaaaatgacttctacaaattgcc Protospacer
.* . ********************.**.**
52. spacer 3.6|1271437|31|NZ_LS483341|PILER-CR matches to NC_002214 (Streptococcus thermophilus bacteriophage Sfi11, complete genome) position: , mismatch: 6, identity: 0.806
ctcgttttgaaaatgacttctacaagttacc CRISPR spacer
ttaaatttgaaaatgacttctacaaattgcc Protospacer
.* . ********************.**.**
53. spacer 3.6|1271437|31|NZ_LS483341|PILER-CR matches to MH892354 (Streptococcus phage SW3, complete genome) position: , mismatch: 6, identity: 0.806
ctcgttttgaaaatgacttctacaagttacc CRISPR spacer
ttaaatttgaaaacgacttctacaaattacc Protospacer
.* . ********.***********.*****
54. spacer 3.6|1271437|31|NZ_LS483341|PILER-CR matches to MH937508 (Streptococcus phage CHPC1156, complete genome) position: , mismatch: 6, identity: 0.806
ctcgttttgaaaatgacttctacaagttacc CRISPR spacer
ttaaatttgaaaacgacttctacaaattacc Protospacer
.* . ********.***********.*****
55. spacer 3.6|1271437|31|NZ_LS483341|PILER-CR matches to MH937469 (Streptococcus phage CHPC919, complete genome) position: , mismatch: 6, identity: 0.806
ctcgttttgaaaatgacttctacaagttacc CRISPR spacer
ttaaatttgaaaatgacttctacaaattgcc Protospacer
.* . ********************.**.**
56. spacer 3.18|1272229|31|NZ_LS483341|PILER-CR matches to NC_015498 (Glaciecola sp. 4H-3-7+YE-5 plasmid pGLAAG01, complete sequence) position: , mismatch: 6, identity: 0.806
ctataacccagaaaactattgaaatcaaggt CRISPR spacer
caacaacccaaaaaacaattgaaatcaggtt Protospacer
* *.******.***** **********.* *
57. spacer 3.21|1271240|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MN856096 (Myoviridae sp. isolate 84, complete genome) position: , mismatch: 6, identity: 0.8
acatcgtcaccagcaagcacaatagctttt CRISPR spacer
gcgttgtcaccagcaagcacaatagccgta Protospacer
.*.*.*********************. *
58. spacer 3.23|1271372|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MF042360 (Pseudomonas phage Phabio, complete genome) position: , mismatch: 6, identity: 0.8
gaacagcatcccagaatttcttaatcttat CRISPR spacer
gaacagcatcacagtatttcttaagagttt Protospacer
********** *** ********* * *
59. spacer 3.23|1271372|30|NZ_LS483341|CRISPRCasFinder,CRT matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 6, identity: 0.8
gaacagcatcccagaatttcttaatcttat CRISPR spacer
ggacaacatctcagaatttcttaattattt Protospacer
*.***.****.**************. * *
60. spacer 3.36|1272230|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MN617835 (Enterobacter phage prasa_myo, complete genome) position: , mismatch: 6, identity: 0.8
tataacccagaaaactattgaaatcaaggt CRISPR spacer
cattacccagaaaactattgacatcacttt Protospacer
.** ***************** **** *
61. spacer 3.36|1272230|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MG999954 (Enterobacter phage myPSH1140, complete genome) position: , mismatch: 6, identity: 0.8
tataacccagaaaactattgaaatcaaggt CRISPR spacer
cattacccagaaaactattgacatcacttt Protospacer
.** ***************** **** *
62. spacer 3.36|1272230|30|NZ_LS483341|CRISPRCasFinder,CRT matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
tataacccagaaaactattg--aaatcaaggt CRISPR spacer
tatatcgcagaaaactattgaaaaattgag-- Protospacer
**** * ************* ****..**
63. spacer 3.36|1272230|30|NZ_LS483341|CRISPRCasFinder,CRT matches to NC_015498 (Glaciecola sp. 4H-3-7+YE-5 plasmid pGLAAG01, complete sequence) position: , mismatch: 6, identity: 0.8
tataacccagaaaactattgaaatcaaggt CRISPR spacer
aacaacccaaaaaacaattgaaatcaggtt Protospacer
*.******.***** **********.* *
64. spacer 3.1|1271107|31|NZ_LS483341|PILER-CR matches to MT811961 (Vibrio phage vB_pir03, complete genome) position: , mismatch: 7, identity: 0.774
ccagaaaagaaaccaacaatgaaaacttcaa CRISPR spacer
ctaatggagaaaccaaccatgaaaactttaa Protospacer
*.*. ..********** **********.**
65. spacer 3.5|1271371|31|NZ_LS483341|PILER-CR matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 7, identity: 0.774
cgaacagcatcccagaatttcttaatcttat CRISPR spacer
aggacaacatctcagaatttcttaattattt Protospacer
*.***.****.**************. * *
66. spacer 3.8|1271569|31|NZ_LS483341|PILER-CR matches to NC_008757 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP01, complete sequence) position: , mismatch: 7, identity: 0.774
catagcctcaagtccgaacttgccttgatag CRISPR spacer
caaagcctcaagtcccaacttgccgagcgcg Protospacer
** ************ ******** * *
67. spacer 3.11|1271767|31|NZ_LS483341|PILER-CR matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.774
catccaacagatcggcatagtggatactatc CRISPR spacer
cttccaacacatcggcatagtgcatgcgtac Protospacer
* ******* ************ **.* *
68. spacer 3.18|1272229|31|NZ_LS483341|PILER-CR matches to MN617835 (Enterobacter phage prasa_myo, complete genome) position: , mismatch: 7, identity: 0.774
ctataacccagaaaactattgaaatcaaggt CRISPR spacer
acattacccagaaaactattgacatcacttt Protospacer
.** ***************** **** *
69. spacer 3.18|1272229|31|NZ_LS483341|PILER-CR matches to MG999954 (Enterobacter phage myPSH1140, complete genome) position: , mismatch: 7, identity: 0.774
ctataacccagaaaactattgaaatcaaggt CRISPR spacer
acattacccagaaaactattgacatcacttt Protospacer
.** ***************** **** *
70. spacer 3.18|1272229|31|NZ_LS483341|PILER-CR matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 7, identity: 0.774
ctataacccagaaaactattg--aaatcaaggt CRISPR spacer
ttatatcgcagaaaactattgaaaaattgag-- Protospacer
.**** * ************* ****..**
71. spacer 3.19|1271108|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MT811961 (Vibrio phage vB_pir03, complete genome) position: , mismatch: 7, identity: 0.767
cagaaaagaaaccaacaatgaaaacttcaa CRISPR spacer
taatggagaaaccaaccatgaaaactttaa Protospacer
.*. ..********** **********.**
72. spacer 3.21|1271240|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MN693976 (Marine virus AFVG_250M247, complete genome) position: , mismatch: 7, identity: 0.767
acatcgtcaccagcaagcacaatagctttt CRISPR spacer
gaagcgtcaccagcaagcacaaaagtcctt Protospacer
. * ****************** **...**
73. spacer 3.26|1271570|30|NZ_LS483341|CRISPRCasFinder,CRT matches to NC_008757 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP01, complete sequence) position: , mismatch: 7, identity: 0.767
atagcctcaagtccgaacttgccttgatag CRISPR spacer
aaagcctcaagtcccaacttgccgagcgcg Protospacer
* ************ ******** * *
74. spacer 3.28|1271702|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MN694282 (Marine virus AFVG_250M297, complete genome) position: , mismatch: 7, identity: 0.767
aaacatatcaactgcttcattggacattac CRISPR spacer
aaacatatcaactgcttcattaattatgtt Protospacer
*********************.. .** .
75. spacer 3.29|1271768|30|NZ_LS483341|CRISPRCasFinder,CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.767
atccaacagatcggcatagtggatactatc CRISPR spacer
ttccaacacatcggcatagtgcatgcgtac Protospacer
******* ************ **.* *
76. spacer 3.36|1272230|30|NZ_LS483341|CRISPRCasFinder,CRT matches to GU323318 (Enterobacteria phage CC31, complete genome) position: , mismatch: 7, identity: 0.767
tataacccagaaaactattgaaatcaaggt CRISPR spacer
cactacccagaaaactattgacatcacttt Protospacer
.*. ***************** **** *
77. spacer 3.11|1271767|31|NZ_LS483341|PILER-CR matches to NZ_CP021334 (Marinobacter salarius strain HL2708#2 plasmid pHL2708Z5, complete sequence) position: , mismatch: 8, identity: 0.742
catccaacagatcggcatagtggatactatc CRISPR spacer
catccaactgctcggcatagtggagggttgt Protospacer
******** * ************* . * .
78. spacer 3.14|1271965|31|NZ_LS483341|PILER-CR matches to MK448886 (Streptococcus phage Javan254, complete genome) position: , mismatch: 8, identity: 0.742
ctataacaagtactaacttaataataatcta CRISPR spacer
cactaataaatactaacttaataataaatac Protospacer
* ***.**.***************** .
79. spacer 3.18|1272229|31|NZ_LS483341|PILER-CR matches to GU323318 (Enterobacteria phage CC31, complete genome) position: , mismatch: 8, identity: 0.742
ctataacccagaaaactattgaaatcaaggt CRISPR spacer
acactacccagaaaactattgacatcacttt Protospacer
.*. ***************** **** *
80. spacer 3.19|1271108|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MN694637 (Marine virus AFVG_250M580, complete genome) position: , mismatch: 8, identity: 0.733
cagaaaagaaaccaacaatgaaaacttcaa CRISPR spacer
cagaaaggaaactaacaatgaaagaaaaca Protospacer
******.*****.**********. *
81. spacer 3.21|1271240|30|NZ_LS483341|CRISPRCasFinder,CRT matches to NC_016936 (Saprospira grandis str. Lewin plasmid, complete sequence) position: , mismatch: 8, identity: 0.733
acatcgtcaccagcaagcacaatagctttt CRISPR spacer
gcgggcccaccagaaagcacaatagctttg Protospacer
.*. .****** ***************
82. spacer 3.29|1271768|30|NZ_LS483341|CRISPRCasFinder,CRT matches to NZ_CP021334 (Marinobacter salarius strain HL2708#2 plasmid pHL2708Z5, complete sequence) position: , mismatch: 8, identity: 0.733
atccaacagatcggcatagtggatactatc CRISPR spacer
atccaactgctcggcatagtggagggttgt Protospacer
******* * ************* . * .
83. spacer 3.32|1271966|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MK448886 (Streptococcus phage Javan254, complete genome) position: , mismatch: 8, identity: 0.733
tataacaagtactaacttaataataatcta CRISPR spacer
actaataaatactaacttaataataaatac Protospacer
***.**.***************** .
84. spacer 3.32|1271966|30|NZ_LS483341|CRISPRCasFinder,CRT matches to KF156338 (Synechococcus phage S-MbCM7, complete genome) position: , mismatch: 8, identity: 0.733
tataacaagtactaacttaataataatcta CRISPR spacer
attgctgaggactaccttaataataatcta Protospacer
*. ..** **** ***************
85. spacer 3.34|1272098|30|NZ_LS483341|CRISPRCasFinder,CRT matches to NZ_CP044460 (Acinetobacter indicus strain B18 plasmid pB18-5, complete sequence) position: , mismatch: 8, identity: 0.733
cttcctcatctttaccaacaataaggatat CRISPR spacer
ggctcgtatctttaacaacaataaggagat Protospacer
..* .******* ************ **
86. spacer 3.1|1271107|31|NZ_LS483341|PILER-CR matches to MN694637 (Marine virus AFVG_250M580, complete genome) position: , mismatch: 9, identity: 0.71
ccagaaaagaaaccaacaatgaaaacttcaa CRISPR spacer
acagaaaggaaactaacaatgaaagaaaaca Protospacer
******.*****.**********. *
87. spacer 3.3|1271239|31|NZ_LS483341|PILER-CR matches to NC_016936 (Saprospira grandis str. Lewin plasmid, complete sequence) position: , mismatch: 9, identity: 0.71
cacatcgtcaccagcaagcacaatagctttt CRISPR spacer
tgcgggcccaccagaaagcacaatagctttg Protospacer
..*. .****** ***************
88. spacer 3.14|1271965|31|NZ_LS483341|PILER-CR matches to KF156338 (Synechococcus phage S-MbCM7, complete genome) position: , mismatch: 9, identity: 0.71
ctataacaagtactaacttaataataatcta CRISPR spacer
tattgctgaggactaccttaataataatcta Protospacer
. *. ..** **** ***************
89. spacer 3.16|1272097|31|NZ_LS483341|PILER-CR matches to NZ_CP044460 (Acinetobacter indicus strain B18 plasmid pB18-5, complete sequence) position: , mismatch: 9, identity: 0.71
ccttcctcatctttaccaacaataaggatat CRISPR spacer
aggctcgtatctttaacaacaataaggagat Protospacer
..* .******* ************ **
90. spacer 3.24|1271438|30|NZ_LS483341|CRISPRCasFinder,CRT matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 9, identity: 0.7
tcgttttgaaaatgacttctacaagttacc CRISPR spacer
tcgttttgaaaatgatttctaatcttctat Protospacer
***************.***** *. .
91. spacer 3.27|1271636|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MN694155 (Marine virus AFVG_250M1019, complete genome) position: , mismatch: 9, identity: 0.7
aacttaagttttaacttacggtcacgaact CRISPR spacer
cgtgtgagtttgaacttacggtcacgatta Protospacer
.. *.***** *************** .
92. spacer 3.30|1271834|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MK249871 (Vibrio phage LP.2, complete genome) position: , mismatch: 9, identity: 0.7
ttttgcgtttttattattacgctcaaagcg CRISPR spacer
ctttgcgtttttcttgttacgctctgccat Protospacer
.*********** **.******** .
93. spacer 3.30|1271834|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MG592508 (Vibrio phage 1.137.O._10N.261.46.B5, partial genome) position: , mismatch: 9, identity: 0.7
ttttgcgtttttattattacgctcaaagcg CRISPR spacer
ctttgcgtttttcttgttacgctcggccat Protospacer
.*********** **.********..
94. spacer 3.30|1271834|30|NZ_LS483341|CRISPRCasFinder,CRT matches to MG592423 (Vibrio phage 1.039.O._10N.286.55.A2, partial genome) position: , mismatch: 9, identity: 0.7
ttttgcgtttttattattacgctcaaagcg CRISPR spacer
ctttgcgtttttcttgttacgctcggccat Protospacer
.*********** **.********..
95. spacer 3.12|1271833|31|NZ_LS483341|PILER-CR matches to MK249871 (Vibrio phage LP.2, complete genome) position: , mismatch: 10, identity: 0.677
cttttgcgtttttattattacgctcaaagcg CRISPR spacer
gctttgcgtttttcttgttacgctctgccat Protospacer
.*********** **.******** .
96. spacer 3.12|1271833|31|NZ_LS483341|PILER-CR matches to MG592508 (Vibrio phage 1.137.O._10N.261.46.B5, partial genome) position: , mismatch: 10, identity: 0.677
cttttgcgtttttattattacgctcaaagcg CRISPR spacer
gctttgcgtttttcttgttacgctcggccat Protospacer
.*********** **.********..
97. spacer 3.12|1271833|31|NZ_LS483341|PILER-CR matches to MG592423 (Vibrio phage 1.039.O._10N.286.55.A2, partial genome) position: , mismatch: 10, identity: 0.677
cttttgcgtttttattattacgctcaaagcg CRISPR spacer
gctttgcgtttttcttgttacgctcggccat Protospacer
.*********** **.********..