Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LS483360 Streptococcus pyogenes strain NCTC10876 chromosome 1 1 crisprs DEDDh,cas3,cas5,cas7,cas4,cas1,cas2,csm6,DinG,csa3 0 1 8 0

Results visualization

1. NZ_LS483360
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LS483360_1 576945-577109 Unclear I-C
2 spacers
cas2,cas1,cas4,cas7,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LS483360_1 1.1|576976|36|NZ_LS483360|CRISPRCasFinder 576976-577011 36 MK448764 Streptococcus phage Javan457, complete genome 22734-22769 2 0.944

1. spacer 1.1|576976|36|NZ_LS483360|CRISPRCasFinder matches to MK448764 (Streptococcus phage Javan457, complete genome) position: , mismatch: 2, identity: 0.944

taaacattaaggaagttatgccagaacccagaacaa	CRISPR spacer
caaacgttaaggaagttatgccagaacccagaacaa	Protospacer
.****.******************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 36640 : 49026 8 Synechococcus_phage(28.57%) NA NA
DBSCAN-SWA_2 758458 : 835059 89 Streptococcus_phage(55.36%) capsid,portal,terminase,holin,integrase,protease,head,tRNA,tail attL 747586:747602|attR 796989:797005
DBSCAN-SWA_3 1045948 : 1081137 55 Streptococcus_phage(67.35%) capsid,portal,terminase,holin,integrase,tail attL 1055448:1055463|attR 1080215:1080230
DBSCAN-SWA_4 1185609 : 1196212 9 Streptococcus_phage(57.14%) NA NA
DBSCAN-SWA_5 1227907 : 1276925 74 Temperate_phage(59.02%) capsid,portal,terminase,holin,integrase,tRNA,tail attL 1218441:1218456|attR 1282962:1282977
DBSCAN-SWA_6 1420490 : 1426861 12 Streptococcus_phage(66.67%) portal NA
DBSCAN-SWA_7 1478961 : 1539010 60 Streptococcus_phage(33.33%) tRNA,bacteriocin,protease NA
DBSCAN-SWA_8 1734948 : 1847684 113 Streptococcus_phage(62.9%) capsid,portal,terminase,holin,integrase,protease,head,tRNA,bacteriocin,tail attL 1765269:1765294|attR 1796951:1796976
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage