Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LS483378 Streptococcus sobrinus strain NCTC12279 chromosome 1 1 crisprs DEDDh,cas3,csa3,RT,DinG 0 1 2 0

Results visualization

1. NZ_LS483378
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LS483378_1 171973-172043 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LS483378_1 1.1|171996|25|NZ_LS483378|CRISPRCasFinder 171996-172020 25 MH648987 Siphoviridae sp. isolate ctcj11, complete genome 23844-23868 3 0.88

1. spacer 1.1|171996|25|NZ_LS483378|CRISPRCasFinder matches to MH648987 (Siphoviridae sp. isolate ctcj11, complete genome) position: , mismatch: 3, identity: 0.88

gagcttgaaaactgggaagcgaggc	CRISPR spacer
gagcttgataactgggaagcgatac	Protospacer
******** ************* .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1265126 : 1272522 8 Streptococcus_phage(50.0%) protease NA
DBSCAN-SWA_2 1874052 : 1924720 50 Staphylococcus_phage(36.36%) transposase,tRNA,bacteriocin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage