Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LS483411 Haemophilus influenzae strain NCTC11426 chromosome 1 3 crisprs DEDDh,DinG,cas3,cas14j,RT 0 1 3 0

Results visualization

1. NZ_LS483411
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LS483411_1 7641-7790 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LS483411_2 618019-618098 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LS483411_3 1461034-1461120 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LS483411_2 2.1|618042|34|NZ_LS483411|CRISPRCasFinder 618042-618075 34 MH572422 Microviridae sp. isolate SD_MC_8, complete genome 4166-4199 9 0.735

1. spacer 2.1|618042|34|NZ_LS483411|CRISPRCasFinder matches to MH572422 (Microviridae sp. isolate SD_MC_8, complete genome) position: , mismatch: 9, identity: 0.735

aaggcgaaagatttcgtggtacttaatggcgatg	CRISPR spacer
tatccgaatgattttgtggtacttaatggtaaaa	Protospacer
 *  **** *****.**************..* .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1022279 : 1096029 52 Mannheimia_phage(17.65%) head,protease,tail,capsid,lysis,portal NA
DBSCAN-SWA_2 1745409 : 1766948 22 Haemophilus_phage(60.0%) head,protease,plate,tail,terminase,capsid NA
DBSCAN-SWA_3 1792311 : 1800851 10 Escherichia_phage(71.43%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage