Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LR215729 Pseudomonas marincola strain YSy11 chromosome PMYSY11 2 crisprs DEDDh,cas3,RT,csa3,WYL,DinG 0 1 8 0

Results visualization

1. NZ_LR215729
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR215729_1 1943621-1943770 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR215729_2 3001601-3001818 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LR215729_2 2.2|3001672|31|NZ_LR215729|CRT 3001672-3001702 31 NZ_CP026518 Deinococcus sp. NW-56 plasmid unnamed2, complete sequence 200939-200969 7 0.774

1. spacer 2.2|3001672|31|NZ_LR215729|CRT matches to NZ_CP026518 (Deinococcus sp. NW-56 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

tggaggccacggtggaagcggcagtggaggc	CRISPR spacer
gcgacgtgacgctggaagcggcattggaggc	Protospacer
  ** *. *** *********** *******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 41929 : 47904 7 Acinetobacter_phage(16.67%) NA NA
DBSCAN-SWA_2 1037102 : 1095582 48 Bacillus_virus(33.33%) protease,tRNA,holin NA
DBSCAN-SWA_3 1865384 : 1932506 40 Acidithiobacillus_phage(25.0%) transposase,holin NA
DBSCAN-SWA_4 3308541 : 3322485 23 Pseudomonas_phage(62.5%) integrase attL 3307647:3307662|attR 3319271:3319286
DBSCAN-SWA_5 3328009 : 3373813 62 Pseudomonas_phage(39.39%) coat,terminase,capsid,tail,holin NA
DBSCAN-SWA_6 3636794 : 3646485 9 Escherichia_phage(28.57%) NA NA
DBSCAN-SWA_7 4151482 : 4158478 9 uncultured_Caudovirales_phage(85.71%) tRNA NA
DBSCAN-SWA_8 4343041 : 4452036 98 uncultured_Caudovirales_phage(54.0%) protease,tRNA,portal,head,terminase,capsid,plate,tail,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage