Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LR594036 Streptococcus porcinus strain NCTC10710 chromosome 1 1 crisprs WYL,DEDDh,cas5,cas8c,cas7,cas4,cas1,cas2,cas3,RT,csm6,DinG 0 2 3 0

Results visualization

1. NZ_LR594036
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR594036_1 387801-388296 TypeI I-C
7 spacers
cas2,cas1,cas4,cas7,cas8c,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LR594036_1 1.2|387898|34|NZ_LR594036|PILER-CR,CRISPRCasFinder,CRT 387898-387931 34 MK448755 Streptococcus phage Javan423, complete genome 11904-11937 0 1.0
NZ_LR594036_1 1.2|387898|34|NZ_LR594036|PILER-CR,CRISPRCasFinder,CRT 387898-387931 34 MK448756 Streptococcus phage Javan425, complete genome 11904-11937 0 1.0
NZ_LR594036_1 1.1|387833|33|NZ_LR594036|PILER-CR,CRISPRCasFinder,CRT 387833-387865 33 MK448998 Streptococcus phage Javan636, complete genome 36896-36928 2 0.939

1. spacer 1.2|387898|34|NZ_LR594036|PILER-CR,CRISPRCasFinder,CRT matches to MK448755 (Streptococcus phage Javan423, complete genome) position: , mismatch: 0, identity: 1.0

taattcagcatgaccgtcatcttcaaaaataaaa	CRISPR spacer
taattcagcatgaccgtcatcttcaaaaataaaa	Protospacer
**********************************

2. spacer 1.2|387898|34|NZ_LR594036|PILER-CR,CRISPRCasFinder,CRT matches to MK448756 (Streptococcus phage Javan425, complete genome) position: , mismatch: 0, identity: 1.0

taattcagcatgaccgtcatcttcaaaaataaaa	CRISPR spacer
taattcagcatgaccgtcatcttcaaaaataaaa	Protospacer
**********************************

3. spacer 1.1|387833|33|NZ_LR594036|PILER-CR,CRISPRCasFinder,CRT matches to MK448998 (Streptococcus phage Javan636, complete genome) position: , mismatch: 2, identity: 0.939

atatcgataacggggtatttactaaaacacttc	CRISPR spacer
atattgataacggggtatttactaagacacttc	Protospacer
****.********************.*******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 172288 : 227144 42 Bacillus_phage(37.5%) protease,transposase,bacteriocin NA
DBSCAN-SWA_2 1219137 : 1293438 85 Streptococcus_phage(72.73%) integrase,capsid,tail,holin,terminase,tRNA,portal attL 1219726:1219742|attR 1299584:1299600
DBSCAN-SWA_3 1502202 : 1516161 19 Streptococcus_phage(84.62%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage