Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LR595858 Streptococcus sp. NCTC 10228 strain NCTC10228 chromosome 1 1 crisprs DEDDh,cas3,RT,DinG,csm6 0 2 8 0

Results visualization

1. NZ_LR595858
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR595858_1 1321139-1321443 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LR595858_1 1.3|1321273|19|NZ_LR595858|CRISPRCasFinder 1321273-1321291 19 LT598654 Phage NCTB genome assembly, complete genome: monopartite 92811-92829 0 1.0
NZ_LR595858_1 1.4|1321318|28|NZ_LR595858|CRISPRCasFinder 1321318-1321345 28 KT345706 Vibrio phage vB_VorS-PVo5, complete genome 48410-48437 7 0.75

1. spacer 1.3|1321273|19|NZ_LR595858|CRISPRCasFinder matches to LT598654 (Phage NCTB genome assembly, complete genome: monopartite) position: , mismatch: 0, identity: 1.0

tagcaccatcacgaccgtt	CRISPR spacer
tagcaccatcacgaccgtt	Protospacer
*******************

2. spacer 1.4|1321318|28|NZ_LR595858|CRISPRCasFinder matches to KT345706 (Vibrio phage vB_VorS-PVo5, complete genome) position: , mismatch: 7, identity: 0.75

gttggccatcttttccgtctcgtccgtt	CRISPR spacer
tctttccatcttttccgtctcgtccagg	Protospacer
 .*  ********************.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 175518 : 223409 39 Bacillus_phage(37.5%) protease,transposase,bacteriocin NA
DBSCAN-SWA_2 281150 : 351715 59 Synechococcus_phage(20.0%) transposase,holin,tRNA,integrase,protease attL 312768:312821|attR 323191:323244
DBSCAN-SWA_3 797839 : 888901 94 Streptococcus_phage(67.69%) terminase,transposase,holin,portal,capsid,tRNA,tail NA
DBSCAN-SWA_4 1539294 : 1553010 19 Streptococcus_phage(84.62%) NA NA
DBSCAN-SWA_5 1665278 : 1674511 8 Bacillus_virus(50.0%) transposase NA
DBSCAN-SWA_6 1686986 : 1772032 107 Streptococcus_phage(70.18%) terminase,transposase,head,holin,portal,bacteriocin,capsid,tRNA,integrase,protease,tail attL 1728049:1728065|attR 1768661:1768677
DBSCAN-SWA_7 2066654 : 2076606 9 Streptococcus_phage(33.33%) transposase,tRNA NA
DBSCAN-SWA_8 2097487 : 2106521 9 Staphylococcus_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage