Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LR655209 Bifidobacterium breve isolate B.breve_1_mod chromosome BILOC7D69C13_1 5 crisprs cas3,WYL,c2c9_V-U4 2 4 0 0

Results visualization

1. NZ_LR655209
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR655209_1 135897-136233 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR655209_2 398620-398929 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR655209_3 1083729-1083814 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR655209_4 2085394-2085539 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR655209_5 2148721-2149004 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LR655209_5 5.2|2148798|26|NZ_LR655209|CRISPRCasFinder 2148798-2148823 26 NZ_LR655209.1 2141486-2141511 1 0.962
NZ_LR655209_5 5.3|2148849|27|NZ_LR655209|CRISPRCasFinder 2148849-2148875 27 NZ_LR655209.1 2141537-2141563 1 0.963

1. spacer 5.2|2148798|26|NZ_LR655209|CRISPRCasFinder matches to position: 2141486-2141511, mismatch: 1, identity: 0.962

gttaaccatgaaatcgctccgctgag	CRISPR spacer
gttaaccatgaaatcgctccgctaag	Protospacer
***********************.**

2. spacer 5.3|2148849|27|NZ_LR655209|CRISPRCasFinder matches to position: 2141537-2141563, mismatch: 1, identity: 0.963

ttaaaacgaagtattgccacactgagc	CRISPR spacer
ttaaaccgaagtattgccacactgagc	Protospacer
***** *********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LR655209_2 2.3|398759|26|NZ_LR655209|CRT 398759-398784 26 NZ_AP022849 Bosea sp. ANAM02 plasmid pANAM02, complete sequence 158326-158351 5 0.808
NZ_LR655209_2 2.5|398876|26|NZ_LR655209|CRT 398876-398901 26 NZ_AP022849 Bosea sp. ANAM02 plasmid pANAM02, complete sequence 158326-158351 5 0.808
NZ_LR655209_1 1.1|135922|27|NZ_LR655209|CRISPRCasFinder 135922-135948 27 NC_010580 Beijerinckia indica subsp. indica ATCC 9039 plasmid pBIND01, complete sequence 89156-89182 7 0.741
NZ_LR655209_2 2.6|398813|33|NZ_LR655209|PILER-CR 398813-398845 33 NZ_LR134455 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence 232231-232263 8 0.758

1. spacer 2.3|398759|26|NZ_LR655209|CRT matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 5, identity: 0.808

cgatttcgaggatgactacgaggatc	CRISPR spacer
cgatttcgaggatgactgcgagcgct	Protospacer
*****************.**** ...

2. spacer 2.5|398876|26|NZ_LR655209|CRT matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 5, identity: 0.808

cgatttcgaggatgactacgaggatc	CRISPR spacer
cgatttcgaggatgactgcgagcgct	Protospacer
*****************.**** ...

3. spacer 1.1|135922|27|NZ_LR655209|CRISPRCasFinder matches to NC_010580 (Beijerinckia indica subsp. indica ATCC 9039 plasmid pBIND01, complete sequence) position: , mismatch: 7, identity: 0.741

cgttgttagcggtacttttttaccagc	CRISPR spacer
gctggttagcggtacttttttacagat	Protospacer
  * ******************* ...

4. spacer 2.6|398813|33|NZ_LR655209|PILER-CR matches to NZ_LR134455 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence) position: , mismatch: 8, identity: 0.758

cgacttcgaccgtgacgaccgcgattcccgcga	CRISPR spacer
ccgcggcgaccgtgacgacctcgagtcccgcat	Protospacer
* .*  ************** *** ******. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage