1. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 0, identity: 1.0
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggcaatggtgg Protospacer
******************************
2. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 0, identity: 1.0
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggcaatggtgg Protospacer
******************************
3. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 0, identity: 1.0
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggcaatggtgg Protospacer
******************************
4. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 0, identity: 1.0
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggcaatggtgg Protospacer
******************************
5. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 0, identity: 1.0
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggcaatggtgg Protospacer
******************************
6. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 0, identity: 1.0
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggcaatggtgg Protospacer
******************************
7. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 0, identity: 1.0
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggcaatggtgg Protospacer
******************************
8. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 0, identity: 1.0
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggcaatggtgg Protospacer
******************************
9. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 0, identity: 1.0
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggcaatggtgg Protospacer
******************************
10. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 0, identity: 1.0
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggcaatggtgg Protospacer
******************************
11. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 0, identity: 1.0
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggcaatggtgg Protospacer
******************************
12. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 0, identity: 1.0
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggcaatggtgg Protospacer
******************************
13. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.967
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaatggcggcggcaatggtgg Protospacer
************.*****************
14. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.967
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggcggcggcaacggcggcggcaatggtgg Protospacer
***.**************************
15. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 1, identity: 0.967
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggcaatggcgg Protospacer
***************************.**
16. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.967
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaatggcggcggcaatggtgg Protospacer
************.*****************
17. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.967
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggcggcggcaacggcggcggcaatggtgg Protospacer
***.**************************
18. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 1, identity: 0.967
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggcaatggcgg Protospacer
***************************.**
19. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 2, identity: 0.933
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcggcaatggtgg Protospacer
.**.**************************
20. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 2, identity: 0.933
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggcaacggcgg Protospacer
************************.**.**
21. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.933
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaatggcggcggcaatggcgg Protospacer
************.**************.**
22. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.933
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaatggcggcggcaatggcgg Protospacer
************.**************.**
23. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 2, identity: 0.933
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaatggcggcggcaatggcgg Protospacer
************.**************.**
24. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 2, identity: 0.933
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaatggtggcggcaatggtgg Protospacer
************.**.**************
25. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 2, identity: 0.933
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcggcaatggtgg Protospacer
.**.**************************
26. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 2, identity: 0.933
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggcaacggcgg Protospacer
************************.**.**
27. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.933
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaatggcggcggcaatggcgg Protospacer
************.**************.**
28. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.933
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaatggcggcggcaatggcgg Protospacer
************.**************.**
29. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 2, identity: 0.933
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaatggcggcggcaatggcgg Protospacer
************.**************.**
30. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 2, identity: 0.933
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaatggtggcggcaatggtgg Protospacer
************.**.**************
31. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggcaacggcggcggcaacggcgg Protospacer
.***********************.**.**
32. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tagcggcggcaacggtggcggcaatggtgg Protospacer
*.*.***********.**************
33. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggcaatggcggcggcaatggcgg Protospacer
.***********.**************.**
34. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcggcaacggtgg Protospacer
.**.********************.*****
35. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggtggcggcaatggtgg Protospacer
.**.***********.**************
36. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcggcaacggtgg Protospacer
.**.********************.*****
37. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcggcaatggcgg Protospacer
.**.***********************.**
38. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggcaacggcggtggcaacggtgg Protospacer
.*****************.*****.*****
39. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP013069 (Pannonibacter phragmitetus strain 31801 plasmid p.p-1, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aggtggaggcaacggcggaggcaatggtgg Protospacer
***** *********** ***********
40. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP032313 (Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aggtggaggcaacggcggaggcaatggtgg Protospacer
***** *********** ***********
41. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcggtaatggtgg Protospacer
.**.*****************.********
42. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcggcaacggtgg Protospacer
.**.********************.*****
43. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcggcaacggtgg Protospacer
.**.********************.*****
44. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggcaacggcggcggcaacggcgg Protospacer
.***********************.**.**
45. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tagcggcggcaacggtggcggcaatggtgg Protospacer
*.*.***********.**************
46. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggcaatggcggcggcaatggcgg Protospacer
.***********.**************.**
47. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcggcaacggtgg Protospacer
.**.********************.*****
48. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggtggcggcaatggtgg Protospacer
.**.***********.**************
49. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcggcaacggtgg Protospacer
.**.********************.*****
50. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcggcaatggcgg Protospacer
.**.***********************.**
51. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggcaacggcggtggcaacggtgg Protospacer
.*****************.*****.*****
52. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP013069 (Pannonibacter phragmitetus strain 31801 plasmid p.p-1, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aggtggaggcaacggcggaggcaatggtgg Protospacer
***** *********** ***********
53. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP032313 (Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aggtggaggcaacggcggaggcaatggtgg Protospacer
***** *********** ***********
54. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcggtaatggtgg Protospacer
.**.*****************.********
55. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcggcaacggtgg Protospacer
.**.********************.*****
56. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.9
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcggcaacggtgg Protospacer
.**.********************.*****
57. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 4, identity: 0.867
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggaaatggcaa Protospacer
********************* *****...
58. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 4, identity: 0.867
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tagcggcggcaacggcggcggcaaggttgg Protospacer
*.*.******************** * ***
59. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 4, identity: 0.867
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tagcggcggcaacggcggcggcaaggttgg Protospacer
*.*.******************** * ***
60. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 4, identity: 0.867
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggaaatggcaa Protospacer
********************* *****...
61. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 4, identity: 0.867
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tagcggcggcaacggcggcggcaaggttgg Protospacer
*.*.******************** * ***
62. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 4, identity: 0.867
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tagcggcggcaacggcggcggcaaggttgg Protospacer
*.*.******************** * ***
63. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggtggcaacggcggcggcggtcatgg Protospacer
******.***************..* .***
64. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaatggtggcggcaatggcaa Protospacer
************.**.***********...
65. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggcggcggcaacggcggcggcaacggcaa Protospacer
***.********************.**...
66. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggttccggcgg Protospacer
*********************. .**.**
67. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggcggcggcaatggcggcggcaatggcaa Protospacer
***.********.**************...
68. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggcggcggaaacggcggcggcaatggcaa Protospacer
***.***** *****************...
69. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaatggcggcggcaacggcaa Protospacer
************.***********.**...
70. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP031358 (Erythrobacter aureus strain YH-07 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgacggcggcaacggcggcggcaatgccgg Protospacer
.*..********************** .**
71. spacer 1.2|121432|30|NZ_LR723676|CRT matches to LR743530 (Xanthomonas phage Suba genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
taccggcggtaacggtggcggcaatggtgg Protospacer
*. .*****.*****.**************
72. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_048792 (Serratia phage Moabite, complete genome) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggtggtaacggcggcggcaatagctg Protospacer
******.**.***************.*. *
73. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP026851 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1) position: , mismatch: 5, identity: 0.833
tggtg-gcggcaacggcggcggcaatggtgg CRISPR spacer
-ggtatgcgccaacggcgacggcaatggtgc Protospacer
***. *** ********.***********
74. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP029719 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
tggtg-gcggcaacggcggcggcaatggtgg CRISPR spacer
-ggtatgcgccaacggcgacggcaatggtgc Protospacer
***. *** ********.***********
75. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP031569 (Enterobacter hormaechei strain 2013_1a plasmid pIncFIB-1301491, complete sequence) position: , mismatch: 5, identity: 0.833
tggtg-gcggcaacggcggcggcaatggtgg CRISPR spacer
-ggtatgcgccaacggcgacggcaatggtgc Protospacer
***. *** ********.***********
76. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.833
tggtg-gcggcaacggcggcggcaatggtgg CRISPR spacer
-ggcgtccggcgacggcggcggccatggtgg Protospacer
**.* ****.*********** *******
77. spacer 1.2|121432|30|NZ_LR723676|CRT matches to MK977695 (Gordonia phage Pupper, complete genome) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg- CRISPR spacer
cagtggcggcaccggcggcggcaa-gatgga Protospacer
..********* ************ *.***
78. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
tggtg-gcggcaacggcggcggcaatggtgg CRISPR spacer
-ggtgcgcggcaactgcggcggcaatgcctg Protospacer
**** ******** ************ . *
79. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP016024 (Ralstonia insidiosa strain ATCC 49129 plasmid pRI-1, complete sequence) position: , mismatch: 5, identity: 0.833
tggtg-gcggcaacggcggcggcaatggtgg CRISPR spacer
-ggtgcgcggcaactgcggcggcaatgcctg Protospacer
**** ******** ************ . *
80. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggtggcaacggcggcggcggtcatgg Protospacer
******.***************..* .***
81. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaatggtggcggcaatggcaa Protospacer
************.**.***********...
82. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggcggcggcaacggcggcggcaacggcaa Protospacer
***.********************.**...
83. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggttccggcgg Protospacer
*********************. .**.**
84. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggcggcggcaatggcggcggcaatggcaa Protospacer
***.********.**************...
85. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggcggcggaaacggcggcggcaatggcaa Protospacer
***.***** *****************...
86. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaatggcggcggcaacggcaa Protospacer
************.***********.**...
87. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP031358 (Erythrobacter aureus strain YH-07 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgacggcggcaacggcggcggcaatgccgg Protospacer
.*..********************** .**
88. spacer 1.4|121540|30|NZ_LR723676|CRT matches to LR743530 (Xanthomonas phage Suba genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
taccggcggtaacggtggcggcaatggtgg Protospacer
*. .*****.*****.**************
89. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_048792 (Serratia phage Moabite, complete genome) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggtggtaacggcggcggcaatagctg Protospacer
******.**.***************.*. *
90. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP026851 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1) position: , mismatch: 5, identity: 0.833
tggtg-gcggcaacggcggcggcaatggtgg CRISPR spacer
-ggtatgcgccaacggcgacggcaatggtgc Protospacer
***. *** ********.***********
91. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP029719 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
tggtg-gcggcaacggcggcggcaatggtgg CRISPR spacer
-ggtatgcgccaacggcgacggcaatggtgc Protospacer
***. *** ********.***********
92. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP031569 (Enterobacter hormaechei strain 2013_1a plasmid pIncFIB-1301491, complete sequence) position: , mismatch: 5, identity: 0.833
tggtg-gcggcaacggcggcggcaatggtgg CRISPR spacer
-ggtatgcgccaacggcgacggcaatggtgc Protospacer
***. *** ********.***********
93. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.833
tggtg-gcggcaacggcggcggcaatggtgg CRISPR spacer
-ggcgtccggcgacggcggcggccatggtgg Protospacer
**.* ****.*********** *******
94. spacer 1.4|121540|30|NZ_LR723676|CRT matches to MK977695 (Gordonia phage Pupper, complete genome) position: , mismatch: 5, identity: 0.833
tggtggcggcaacggcggcggcaatggtgg- CRISPR spacer
cagtggcggcaccggcggcggcaa-gatgga Protospacer
..********* ************ *.***
95. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
tggtg-gcggcaacggcggcggcaatggtgg CRISPR spacer
-ggtgcgcggcaactgcggcggcaatgcctg Protospacer
**** ******** ************ . *
96. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP016024 (Ralstonia insidiosa strain ATCC 49129 plasmid pRI-1, complete sequence) position: , mismatch: 5, identity: 0.833
tggtg-gcggcaacggcggcggcaatggtgg CRISPR spacer
-ggtgcgcggcaactgcggcggcaatgcctg Protospacer
**** ******** ************ . *
97. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggcggccacgg Protospacer
**********************... ..**
98. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggcggcggcaacggcggcggcggccatgg Protospacer
***.******************... .***
99. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcggcggtcatgg Protospacer
.**.******************..* .***
100. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP032313 (Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
ggaaggcggcaacggcggcggcaaagggtg Protospacer
*. ******************** ** *
101. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggcggcggcaacggcggcggcggtaacgg Protospacer
***.******************..*...**
102. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
agccggcggcgacggcggcagcaatggtgc Protospacer
* .******.********.*********
103. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggaggcaacggcggcggcaatggcaa Protospacer
.**.** ********************...
104. spacer 1.2|121432|30|NZ_LR723676|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caatggcggcaacggcggcggcaatggcaa Protospacer
...************************...
105. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
ctccggcggcaacggcggcggcagcggtgg Protospacer
. .*******************..*****
106. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacgtcgtcggcaagagaag Protospacer
************** ** ****** .* .*
107. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcaacggcaatggcggcggcaatggcgg Protospacer
.**...******.**************.**
108. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggcggcggcaacggcggcagcaatagcgc Protospacer
**.***************.*****.*.*
109. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggcggcggcaacggcggcagcaatagcgc Protospacer
**.***************.*****.*.*
110. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caagggcggcaatggcggcggcaatggcgg Protospacer
... ********.**************.**
111. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacagcggcggcaacaagga Protospacer
*************.**********... *.
112. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_041916 (Vibrio phage pTD1 DNA, complete genome) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caacggcggcaatggcggcggcaatggcgg Protospacer
....********.**************.**
113. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
agccggcggcgacggcggcagcaatggtgc Protospacer
* .******.********.*********
114. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaatggcggcggcaatggcaa Protospacer
.**.********.**************...
115. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tacctgcggcagcgacggcggcaatggtgg Protospacer
*. . ******.**.***************
116. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_LR134469 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 27, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggtggcggcaacggcgggggcaacaaggg Protospacer
***************** *****... **
117. spacer 1.2|121432|30|NZ_LR723676|CRT matches to AJ297913 (Uncultured bacterium plasmid pIPO2T, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tcagggcggcaacggcggcggcgctggtga Protospacer
* . ******************. *****.
118. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tgccgcccgcaacggcggcggcaacggtgc Protospacer
** .* * ****************.****
119. spacer 1.2|121432|30|NZ_LR723676|CRT matches to CP058906 (Micromonospora phage pMLP1, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggtggcggcgacggcggcggcgatgaggt Protospacer
*********.***********.***. *
120. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggctccggcggcggcggcggcaatggtgg Protospacer
**. ****..******************
121. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 6, identity: 0.8
--tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gtcgat--cggcggcggcggcggcaatggtgg Protospacer
.*.* ****..******************
122. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP016618 (Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgggaacggcaacggtggcggcaatggtag Protospacer
.** ..*********.************.*
123. spacer 1.2|121432|30|NZ_LR723676|CRT matches to MN734439 (Sphingomonas phage Kharn, complete genome) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggcttcggcggcggcaatcaggg Protospacer
.********* ************* . **
124. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
agggaacggcaatggcggtggcaatggtgg Protospacer
** ..******.*****.***********
125. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tgcggtcggcaattgcggcggcaatggtgt Protospacer
** * ******. ***************
126. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
agggaacggcaatggcggtggcaatggtgg Protospacer
** ..******.*****.***********
127. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_017959 (Tistrella mobilis KA081020-065 plasmid pTM4, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg-- CRISPR spacer
tggtggcggcagcggcggcggc--cggctgat Protospacer
***********.********** .**. *
128. spacer 1.2|121432|30|NZ_LR723676|CRT matches to MN175604 (Gordonia phage PhorbesPhlower, complete genome) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggcggcggcaacggcggcggcatggtcgg Protospacer
**.******************* * .**
129. spacer 1.2|121432|30|NZ_LR723676|CRT matches to KM233261 (Sulfitobacter phage NYA-2014a, complete genome) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggctacggcgggggcaactccgg Protospacer
********** ******* *****. .**
130. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcgacggcggcggacatcgccg Protospacer
**********.********** ** *. *
131. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_014818 (Asticcacaulis excentricus CB 48 plasmid pASTEX01, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcgg-caatggtgg CRISPR spacer
cggtggcggccacggcggcggcctgtggcg- Protospacer
.********* ********** * .***.*
132. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcgggaacggcggcggtggaggcgg Protospacer
********* ***********... **.**
133. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggcaatggcggcggcggcggcgg Protospacer
.***********.*********...**.**
134. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP047177 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcgggaacggcggcggtggaggcgg Protospacer
********* ***********... **.**
135. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcgacggcggcggacatcgccg Protospacer
**********.********** ** *. *
136. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP041605 (Streptomyces sp. S1D4-14 plasmid pS1D4-14.1, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggaggcggcaagggcggcggcaagtgggg Protospacer
.** ******** *********** * **
137. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcggcggccacgg Protospacer
**********************... ..**
138. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggcggcggcaacggcggcggcggccatgg Protospacer
***.******************... .***
139. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcggcggtcatgg Protospacer
.**.******************..* .***
140. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP032313 (Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
ggaaggcggcaacggcggcggcaaagggtg Protospacer
*. ******************** ** *
141. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggcggcggcaacggcggcggcggtaacgg Protospacer
***.******************..*...**
142. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
agccggcggcgacggcggcagcaatggtgc Protospacer
* .******.********.*********
143. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggaggcaacggcggcggcaatggcaa Protospacer
.**.** ********************...
144. spacer 1.4|121540|30|NZ_LR723676|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caatggcggcaacggcggcggcaatggcaa Protospacer
...************************...
145. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
ctccggcggcaacggcggcggcagcggtgg Protospacer
. .*******************..*****
146. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacgtcgtcggcaagagaag Protospacer
************** ** ****** .* .*
147. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcaacggcaatggcggcggcaatggcgg Protospacer
.**...******.**************.**
148. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggcggcggcaacggcggcagcaatagcgc Protospacer
**.***************.*****.*.*
149. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggcggcggcaacggcggcagcaatagcgc Protospacer
**.***************.*****.*.*
150. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caagggcggcaatggcggcggcaatggcgg Protospacer
... ********.**************.**
151. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacagcggcggcaacaagga Protospacer
*************.**********... *.
152. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_041916 (Vibrio phage pTD1 DNA, complete genome) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caacggcggcaatggcggcggcaatggcgg Protospacer
....********.**************.**
153. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
agccggcggcgacggcggcagcaatggtgc Protospacer
* .******.********.*********
154. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaatggcggcggcaatggcaa Protospacer
.**.********.**************...
155. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tacctgcggcagcgacggcggcaatggtgg Protospacer
*. . ******.**.***************
156. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_LR134469 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 27, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggtggcggcaacggcgggggcaacaaggg Protospacer
***************** *****... **
157. spacer 1.4|121540|30|NZ_LR723676|CRT matches to AJ297913 (Uncultured bacterium plasmid pIPO2T, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tcagggcggcaacggcggcggcgctggtga Protospacer
* . ******************. *****.
158. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tgccgcccgcaacggcggcggcaacggtgc Protospacer
** .* * ****************.****
159. spacer 1.4|121540|30|NZ_LR723676|CRT matches to CP058906 (Micromonospora phage pMLP1, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggtggcggcgacggcggcggcgatgaggt Protospacer
*********.***********.***. *
160. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggctccggcggcggcggcggcaatggtgg Protospacer
**. ****..******************
161. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 6, identity: 0.8
--tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gtcgat--cggcggcggcggcggcaatggtgg Protospacer
.*.* ****..******************
162. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP016618 (Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgggaacggcaacggtggcggcaatggtag Protospacer
.** ..*********.************.*
163. spacer 1.4|121540|30|NZ_LR723676|CRT matches to MN734439 (Sphingomonas phage Kharn, complete genome) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggcttcggcggcggcaatcaggg Protospacer
.********* ************* . **
164. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
agggaacggcaatggcggtggcaatggtgg Protospacer
** ..******.*****.***********
165. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tgcggtcggcaattgcggcggcaatggtgt Protospacer
** * ******. ***************
166. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
agggaacggcaatggcggtggcaatggtgg Protospacer
** ..******.*****.***********
167. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_017959 (Tistrella mobilis KA081020-065 plasmid pTM4, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg-- CRISPR spacer
tggtggcggcagcggcggcggc--cggctgat Protospacer
***********.********** .**. *
168. spacer 1.4|121540|30|NZ_LR723676|CRT matches to MN175604 (Gordonia phage PhorbesPhlower, complete genome) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggcggcggcaacggcggcggcatggtcgg Protospacer
**.******************* * .**
169. spacer 1.4|121540|30|NZ_LR723676|CRT matches to KM233261 (Sulfitobacter phage NYA-2014a, complete genome) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggctacggcgggggcaactccgg Protospacer
********** ******* *****. .**
170. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcgacggcggcggacatcgccg Protospacer
**********.********** ** *. *
171. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_014818 (Asticcacaulis excentricus CB 48 plasmid pASTEX01, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcgg-caatggtgg CRISPR spacer
cggtggcggccacggcggcggcctgtggcg- Protospacer
.********* ********** * .***.*
172. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcgggaacggcggcggtggaggcgg Protospacer
********* ***********... **.**
173. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggcaatggcggcggcggcggcgg Protospacer
.***********.*********...**.**
174. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP047177 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcgggaacggcggcggtggaggcgg Protospacer
********* ***********... **.**
175. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcgacggcggcggacatcgccg Protospacer
**********.********** ** *. *
176. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP041605 (Streptomyces sp. S1D4-14 plasmid pS1D4-14.1, complete sequence) position: , mismatch: 6, identity: 0.8
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggaggcggcaagggcggcggcaagtgggg Protospacer
.** ******** *********** * **
177. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcagcaacaacgg Protospacer
.**.***************.****....**
178. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggtggcaacggcggcggcggcggccg Protospacer
.*****.***************...**. *
179. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcaatggcaatggtggcggcaatggtgg Protospacer
.**....*****.**.**************
180. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggccacggcggcggcggtaacgg Protospacer
.********* ***********..*...**
181. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aaaaagcggcaatggcggcggcaatggcgg Protospacer
.. .*******.**************.**
182. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caaaagcggcaatggcggcggcaatggcgg Protospacer
... .*******.**************.**
183. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcaatggcaatggcggcggcaatggcgg Protospacer
.**....*****.**************.**
184. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggccacggcggcggcggtaacgg Protospacer
.********* ***********..*...**
185. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caaaagcggcaatggcggcggcaacggtgg Protospacer
... .*******.***********.*****
186. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggcagtggcggcggcaagcgtct Protospacer
.**********..*********** **
187. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aaacaacggcaacggcggcggcaatggcgg Protospacer
.....*********************.**
188. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaacggcggcggcaatggtgc Protospacer
.* .* *********************
189. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP039924 (Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129a, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cagtggcggcaacggcaacggcaattcggg Protospacer
..**************..******* **
190. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_012853 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132503, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gagcaatggcaacagcggcggcaatggtgg Protospacer
.*....******.****************
191. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aggcaacggaaacggcggcggcaatggtaa Protospacer
**...*** ******************..
192. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggtaatggcaacggcgggggcaatggtaa Protospacer
***...*********** *********..
193. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaacggcggcggcaatggtgc Protospacer
.* .* *********************
194. spacer 1.2|121432|30|NZ_LR723676|CRT matches to MN710383 (Pseudomonas phage pf8_ST274-AUS411, complete genome) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgggggcgacaacggcggcggcaatgacaa Protospacer
.** ****.*****************....
195. spacer 1.2|121432|30|NZ_LR723676|CRT matches to AY324828 (Pseudomonas phage Pf1, complete prophage) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgggggcgacaacggcggcggcaatgacaa Protospacer
.** ****.*****************....
196. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccaacggcaacggtggcggcaacggtgg Protospacer
.* ...*********.********.*****
197. spacer 1.2|121432|30|NZ_LR723676|CRT matches to AB276040 (Ralstonia phage RSA1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtgacggcaacggcggcggcggacgtac Protospacer
*****.****************.. **.
198. spacer 1.2|121432|30|NZ_LR723676|CRT matches to AB981169 (Ralstonia phage RSY1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtgacggcaacggcggcggcggacgtac Protospacer
*****.****************.. **.
199. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_009382 (Ralstonia phage phiRSA1, complete genome) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtgacggcaacggcggcggcggacgtac Protospacer
*****.****************.. **.
200. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gaaggacgggaacggcggcggcaatggcgg Protospacer
.. *.*** *****************.**
201. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggcgtcggcaacggcggcggcagagcgcg Protospacer
***.* *****************. * *
202. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggcggcggcaacggcggcggcgacgtctt Protospacer
***.******************.*.* .
203. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgcgctcggcaacggcgggggcaatggcgg Protospacer
.* ************ ********.**
204. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cattggcggcaacagcggcggcaacagcgg Protospacer
.. **********.**********..*.**
205. spacer 1.2|121432|30|NZ_LR723676|CRT matches to MH319744 (Marine virus AG-345-E15 Ga0172270_14 genomic sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
ctctaacggcaacggtggcggcaacggtgg Protospacer
. *..*********.********.*****
206. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tttcggcggccaccgcggcggcaatggcgc Protospacer
* .****** ** *************.*
207. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg---- CRISPR spacer
cggtggcggcaacggcggcagc----gtgcaaac Protospacer
.******************.** ***
208. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgctgcgcgcaatggcggcggcaatggtgc Protospacer
.* ** ****.****************
209. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP015420 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggtggcggcatcggcggcggcgggggcga Protospacer
********** **********.. **.*.
210. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtgacggcagcggcggcggcaagcatcg Protospacer
.****.*****.************ .* *
211. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggaggcagcggcggcggcaacgaggc Protospacer
.***** ****.************.*. *
212. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP035502 (Sphingosinicella sp. BN140058 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg---- CRISPR spacer
tggtggcggcagcggcggcggt----gtgacccc Protospacer
***********.*********. ***.
213. spacer 1.2|121432|30|NZ_LR723676|CRT matches to MF919498 (Mycobacterium phage Cindaradix, complete genome) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggtggcaacggcggcggcggtagccg Protospacer
.*****.***************..*.*. *
214. spacer 1.2|121432|30|NZ_LR723676|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg---- CRISPR spacer
cggtggcggcgacggcggcggc----gcggccct Protospacer
.*********.*********** *.**
215. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tccctggggcaaccgcggcggcaatggcgg Protospacer
* . * ****** *************.**
216. spacer 1.2|121432|30|NZ_LR723676|CRT matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggtggcgacaagggcggcggcaaagccga Protospacer
*******.*** *********** * .*.
217. spacer 1.2|121432|30|NZ_LR723676|CRT matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggtggcgacaagggcggcggcaaagccga Protospacer
*******.*** *********** * .*.
218. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggtggcgacaagggcggcggcaaagccga Protospacer
*******.*** *********** * .*.
219. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcagcaacaacgg Protospacer
.**.***************.****....**
220. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggtggcaacggcggcggcggcggccg Protospacer
.*****.***************...**. *
221. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcaatggcaatggtggcggcaatggtgg Protospacer
.**....*****.**.**************
222. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggccacggcggcggcggtaacgg Protospacer
.********* ***********..*...**
223. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aaaaagcggcaatggcggcggcaatggcgg Protospacer
.. .*******.**************.**
224. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caaaagcggcaatggcggcggcaatggcgg Protospacer
... .*******.**************.**
225. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcaatggcaatggcggcggcaatggcgg Protospacer
.**....*****.**************.**
226. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggccacggcggcggcggtaacgg Protospacer
.********* ***********..*...**
227. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caaaagcggcaatggcggcggcaacggtgg Protospacer
... .*******.***********.*****
228. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggcagtggcggcggcaagcgtct Protospacer
.**********..*********** **
229. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aaacaacggcaacggcggcggcaatggcgg Protospacer
.....*********************.**
230. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaacggcggcggcaatggtgc Protospacer
.* .* *********************
231. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP039924 (Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129a, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cagtggcggcaacggcaacggcaattcggg Protospacer
..**************..******* **
232. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_012853 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132503, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gagcaatggcaacagcggcggcaatggtgg Protospacer
.*....******.****************
233. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aggcaacggaaacggcggcggcaatggtaa Protospacer
**...*** ******************..
234. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggtaatggcaacggcgggggcaatggtaa Protospacer
***...*********** *********..
235. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaacggcggcggcaatggtgc Protospacer
.* .* *********************
236. spacer 1.4|121540|30|NZ_LR723676|CRT matches to MN710383 (Pseudomonas phage pf8_ST274-AUS411, complete genome) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgggggcgacaacggcggcggcaatgacaa Protospacer
.** ****.*****************....
237. spacer 1.4|121540|30|NZ_LR723676|CRT matches to AY324828 (Pseudomonas phage Pf1, complete prophage) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgggggcgacaacggcggcggcaatgacaa Protospacer
.** ****.*****************....
238. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccaacggcaacggtggcggcaacggtgg Protospacer
.* ...*********.********.*****
239. spacer 1.4|121540|30|NZ_LR723676|CRT matches to AB276040 (Ralstonia phage RSA1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtgacggcaacggcggcggcggacgtac Protospacer
*****.****************.. **.
240. spacer 1.4|121540|30|NZ_LR723676|CRT matches to AB981169 (Ralstonia phage RSY1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtgacggcaacggcggcggcggacgtac Protospacer
*****.****************.. **.
241. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_009382 (Ralstonia phage phiRSA1, complete genome) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtgacggcaacggcggcggcggacgtac Protospacer
*****.****************.. **.
242. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gaaggacgggaacggcggcggcaatggcgg Protospacer
.. *.*** *****************.**
243. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggcgtcggcaacggcggcggcagagcgcg Protospacer
***.* *****************. * *
244. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggcggcggcaacggcggcggcgacgtctt Protospacer
***.******************.*.* .
245. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgcgctcggcaacggcgggggcaatggcgg Protospacer
.* ************ ********.**
246. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cattggcggcaacagcggcggcaacagcgg Protospacer
.. **********.**********..*.**
247. spacer 1.4|121540|30|NZ_LR723676|CRT matches to MH319744 (Marine virus AG-345-E15 Ga0172270_14 genomic sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
ctctaacggcaacggtggcggcaacggtgg Protospacer
. *..*********.********.*****
248. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tttcggcggccaccgcggcggcaatggcgc Protospacer
* .****** ** *************.*
249. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg---- CRISPR spacer
cggtggcggcaacggcggcagc----gtgcaaac Protospacer
.******************.** ***
250. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgctgcgcgcaatggcggcggcaatggtgc Protospacer
.* ** ****.****************
251. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP015420 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggtggcggcatcggcggcggcgggggcga Protospacer
********** **********.. **.*.
252. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtgacggcagcggcggcggcaagcatcg Protospacer
.****.*****.************ .* *
253. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggaggcagcggcggcggcaacgaggc Protospacer
.***** ****.************.*. *
254. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP035502 (Sphingosinicella sp. BN140058 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg---- CRISPR spacer
tggtggcggcagcggcggcggt----gtgacccc Protospacer
***********.*********. ***.
255. spacer 1.4|121540|30|NZ_LR723676|CRT matches to MF919498 (Mycobacterium phage Cindaradix, complete genome) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggtggcaacggcggcggcggtagccg Protospacer
.*****.***************..*.*. *
256. spacer 1.4|121540|30|NZ_LR723676|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg---- CRISPR spacer
cggtggcggcgacggcggcggc----gcggccct Protospacer
.*********.*********** *.**
257. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tccctggggcaaccgcggcggcaatggcgg Protospacer
* . * ****** *************.**
258. spacer 1.4|121540|30|NZ_LR723676|CRT matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggtggcgacaagggcggcggcaaagccga Protospacer
*******.*** *********** * .*.
259. spacer 1.4|121540|30|NZ_LR723676|CRT matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggtggcgacaagggcggcggcaaagccga Protospacer
*******.*** *********** * .*.
260. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 7, identity: 0.767
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggtggcgacaagggcggcggcaaagccga Protospacer
*******.*** *********** * .*.
261. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gaaaggcggcaatggcggcggcaattgctg Protospacer
.. ********.************ *. *
262. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgaaaacggcaacggccgcggcaatgctga Protospacer
.*. ..********** ********* **.
263. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gacacgcggcaactgcggcggcaagggtgc Protospacer
. ******** ********** ****
264. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gacacgcggcaactgcggcggcaagggtgc Protospacer
. ******** ********** ****
265. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gaatggtggcaatggcggcggcaatggcaa Protospacer
..***.*****.**************...
266. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgaaaacggcaacggccgcggcaatgctga Protospacer
.*. ..********** ********* **.
267. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP033036 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13a, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cagtggcggcaacggcaacggcaattcgga Protospacer
..**************..******* *.
268. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caaaaacggcaatggcggcggcaacggtgg Protospacer
... ..******.***********.*****
269. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcagcgcacggaa Protospacer
*******************.**. * ..
270. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP007050 (Rhizobium leguminosarum bv. trifolii WSM1689 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gcatcccggcaacggcgccggcaatggttc Protospacer
.* *********** **********
271. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caagggcggaaacggtggcggcaatggtaa Protospacer
... ***** *****.************..
272. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_AP014580 (Burkholderia sp. RPE67 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gacacgcggcaactgcggcggcaagggtgc Protospacer
. ******** ********** ****
273. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cttcggcggcaagggcggcggcgatggttt Protospacer
. .******** *********.*****
274. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_016591 (Burkholderia sp. YI23 plasmid byi_2p, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gacacgcggcaactgcggcggcaagggtgc Protospacer
. ******** ********** ****
275. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_AP022558 (Geobacillus subterraneus strain E55-1 plasmid pGspE55-1, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caaatgcggcaatggcggcggcaatgttga Protospacer
... *******.************* **.
276. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggtggcggcaccggcggcggcaccccgcg Protospacer
********** *********** . *
277. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP027794 (Rhodococcus hoagii strain DSSKP-R-001 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggcaacggtggcggctcgaacgg Protospacer
.**************.****** ...**
278. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP015091 (Pelagibaca abyssi strain JLT2014 plasmid pPABY1, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aggcggcggcgacggcggcggcaagccccg Protospacer
**.******.************* . *
279. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
280. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
281. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
282. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_019318 (Ralstonia pickettii plasmid p712, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gagtggcggcgacggcggcggcgatcttat Protospacer
.********.***********.** *.
283. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
ggttggcggcaacggcagcggcaagagcac Protospacer
* *************.******* .*..
284. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
285. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcacgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
286. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
287. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
288. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_011667 (Thauera sp. MZ1T plasmid pTha01, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cttgcgcggcaaggtcggcggcaatggttg Protospacer
. ******* * ************* *
289. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcacgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
290. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
291. spacer 1.2|121432|30|NZ_LR723676|CRT matches to JX469827 (Uncultured bacterium plasmid pEMT3, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gagtggcggcgacggcggcggcgatcttat Protospacer
.********.***********.** *.
292. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
293. spacer 1.2|121432|30|NZ_LR723676|CRT matches to JN106170 (Uncultured bacterium plasmid pAKD25, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gagtggcggcgacggcggcggcgatcttat Protospacer
.********.***********.** *.
294. spacer 1.2|121432|30|NZ_LR723676|CRT matches to JN106175 (Uncultured bacterium plasmid pAKD34, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gagtggcggcgacggcggcggcgatcttat Protospacer
.********.***********.** *.
295. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
296. spacer 1.2|121432|30|NZ_LR723676|CRT matches to JN106167 (Uncultured bacterium plasmid pAKD16, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gagtggcggcgacggcggcggcgatcttat Protospacer
.********.***********.** *.
297. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
298. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
299. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
ctccggcggcaacggcgacggcaagggcga Protospacer
. .*************.****** **.*.
300. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
ggaaggcggcctcggcggcggcaatggctt Protospacer
*. ****** ***************.
301. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP024313 (Rhizobium sp. NXC24 plasmid pRspNXC24b, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
ccacggcggcatccgcggcggcaatggcga Protospacer
. ..******* * *************.*.
302. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
ggatggcggcaacggcagcggcaagtcgga Protospacer
*.*************.******* *.
303. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
304. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
305. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gaaaggcggcaatggcggcggcaattgctg Protospacer
.. ********.************ *. *
306. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgaaaacggcaacggccgcggcaatgctga Protospacer
.*. ..********** ********* **.
307. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gacacgcggcaactgcggcggcaagggtgc Protospacer
. ******** ********** ****
308. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gacacgcggcaactgcggcggcaagggtgc Protospacer
. ******** ********** ****
309. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gaatggtggcaatggcggcggcaatggcaa Protospacer
..***.*****.**************...
310. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgaaaacggcaacggccgcggcaatgctga Protospacer
.*. ..********** ********* **.
311. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP033036 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13a, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cagtggcggcaacggcaacggcaattcgga Protospacer
..**************..******* *.
312. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caaaaacggcaatggcggcggcaacggtgg Protospacer
... ..******.***********.*****
313. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
tggtggcggcaacggcggcagcgcacggaa Protospacer
*******************.**. * ..
314. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP007050 (Rhizobium leguminosarum bv. trifolii WSM1689 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gcatcccggcaacggcgccggcaatggttc Protospacer
.* *********** **********
315. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caagggcggaaacggtggcggcaatggtaa Protospacer
... ***** *****.************..
316. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_AP014580 (Burkholderia sp. RPE67 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gacacgcggcaactgcggcggcaagggtgc Protospacer
. ******** ********** ****
317. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cttcggcggcaagggcggcggcgatggttt Protospacer
. .******** *********.*****
318. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_016591 (Burkholderia sp. YI23 plasmid byi_2p, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gacacgcggcaactgcggcggcaagggtgc Protospacer
. ******** ********** ****
319. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_AP022558 (Geobacillus subterraneus strain E55-1 plasmid pGspE55-1, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caaatgcggcaatggcggcggcaatgttga Protospacer
... *******.************* **.
320. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggtggcggcaccggcggcggcaccccgcg Protospacer
********** *********** . *
321. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP027794 (Rhodococcus hoagii strain DSSKP-R-001 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggcaacggtggcggctcgaacgg Protospacer
.**************.****** ...**
322. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP015091 (Pelagibaca abyssi strain JLT2014 plasmid pPABY1, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aggcggcggcgacggcggcggcaagccccg Protospacer
**.******.************* . *
323. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
324. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
325. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
326. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_019318 (Ralstonia pickettii plasmid p712, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gagtggcggcgacggcggcggcgatcttat Protospacer
.********.***********.** *.
327. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
ggttggcggcaacggcagcggcaagagcac Protospacer
* *************.******* .*..
328. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
329. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcacgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
330. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
331. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
332. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_011667 (Thauera sp. MZ1T plasmid pTha01, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cttgcgcggcaaggtcggcggcaatggttg Protospacer
. ******* * ************* *
333. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcacgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
334. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
335. spacer 1.4|121540|30|NZ_LR723676|CRT matches to JX469827 (Uncultured bacterium plasmid pEMT3, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gagtggcggcgacggcggcggcgatcttat Protospacer
.********.***********.** *.
336. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
337. spacer 1.4|121540|30|NZ_LR723676|CRT matches to JN106170 (Uncultured bacterium plasmid pAKD25, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gagtggcggcgacggcggcggcgatcttat Protospacer
.********.***********.** *.
338. spacer 1.4|121540|30|NZ_LR723676|CRT matches to JN106175 (Uncultured bacterium plasmid pAKD34, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gagtggcggcgacggcggcggcgatcttat Protospacer
.********.***********.** *.
339. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
340. spacer 1.4|121540|30|NZ_LR723676|CRT matches to JN106167 (Uncultured bacterium plasmid pAKD16, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gagtggcggcgacggcggcggcgatcttat Protospacer
.********.***********.** *.
341. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
342. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
343. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
ctccggcggcaacggcgacggcaagggcga Protospacer
. .*************.****** **.*.
344. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
ggaaggcggcctcggcggcggcaatggctt Protospacer
*. ****** ***************.
345. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP024313 (Rhizobium sp. NXC24 plasmid pRspNXC24b, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
ccacggcggcatccgcggcggcaatggcga Protospacer
. ..******* * *************.*.
346. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
ggatggcggcaacggcagcggcaagtcgga Protospacer
*.*************.******* *.
347. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
348. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 8, identity: 0.733
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cgccgcgcgcaatggcggcggcaatggtgc Protospacer
.* .* ****.****************
349. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcgggaacaagaa Protospacer
.**.***************** **... ..
350. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caagggcggaaacggcggcggtaatggcaa Protospacer
... ***** ***********.*****...
351. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aaagggcggaaatggcggcggcaatggaaa Protospacer
.. ***** **.************** ..
352. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aaagggcggaaatggcggcggcaatggaaa Protospacer
.. ***** **.************** ..
353. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_019959 (Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aggtggcggcaagggcggcggcagccccat Protospacer
*********** **********.. ..
354. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_009339 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcagcggcaagaccca Protospacer
.**.************.******* . . .
355. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gaaccccggcaaaagcggcggcaatggtgc Protospacer
... ****** .***************
356. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggaagcggcggcggcaacaccac Protospacer
.******** *.************.. ..
357. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP040642 (Agrobacterium sp. T29 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caaaggcgccaacagcggcggcaatggcac Protospacer
... **** ****.*************..
358. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggcggcggcaacggcggcgtcaacatcct Protospacer
**.**************** ***.. .
359. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggcggcggcaacggcggcgtcaacatcct Protospacer
**.**************** ***.. .
360. spacer 1.2|121432|30|NZ_LR723676|CRT matches to MG872843 (Mycobacterium phage Sotrice96, complete genome) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cactggcggcaacggcggcgccaaggcgta Protospacer
.. ***************** *** * .
361. spacer 1.2|121432|30|NZ_LR723676|CRT matches to MT723943 (Mycobacterium phage Cactus, complete genome) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cactggcggcaacggcggcgccaaggcgta Protospacer
.. ***************** *** * .
362. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcggcgggaacaagaa Protospacer
.**.***************** **... ..
363. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caagggcggaaacggcggcggtaatggcaa Protospacer
... ***** ***********.*****...
364. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aaagggcggaaatggcggcggcaatggaaa Protospacer
.. ***** **.************** ..
365. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aaagggcggaaatggcggcggcaatggaaa Protospacer
.. ***** **.************** ..
366. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_019959 (Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aggtggcggcaagggcggcggcagccccat Protospacer
*********** **********.. ..
367. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_009339 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggcggcggcaacggcagcggcaagaccca Protospacer
.**.************.******* . . .
368. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gaaccccggcaaaagcggcggcaatggtgc Protospacer
... ****** .***************
369. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cggtggcggaagcggcggcggcaacaccac Protospacer
.******** *.************.. ..
370. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP040642 (Agrobacterium sp. T29 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
caaaggcgccaacagcggcggcaatggcac Protospacer
... **** ****.*************..
371. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggcggcggcaacggcggcgtcaacatcct Protospacer
**.**************** ***.. .
372. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
gggcggcggcaacggcggcgtcaacatcct Protospacer
**.**************** ***.. .
373. spacer 1.4|121540|30|NZ_LR723676|CRT matches to MG872843 (Mycobacterium phage Sotrice96, complete genome) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cactggcggcaacggcggcgccaaggcgta Protospacer
.. ***************** *** * .
374. spacer 1.4|121540|30|NZ_LR723676|CRT matches to MT723943 (Mycobacterium phage Cactus, complete genome) position: , mismatch: 9, identity: 0.7
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cactggcggcaacggcggcgccaaggcgta Protospacer
.. ***************** *** * .
375. spacer 1.2|121432|30|NZ_LR723676|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 10, identity: 0.667
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aaacaacggcaatggcggcggcaatggcaa Protospacer
.....******.**************...
376. spacer 1.2|121432|30|NZ_LR723676|CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 10, identity: 0.667
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cccgtgcggcaacggcggcggcattgcccc Protospacer
. ****************** ** .
377. spacer 1.4|121540|30|NZ_LR723676|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 10, identity: 0.667
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
aaacaacggcaatggcggcggcaatggcaa Protospacer
.....******.**************...
378. spacer 1.4|121540|30|NZ_LR723676|CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 10, identity: 0.667
tggtggcggcaacggcggcggcaatggtgg CRISPR spacer
cccgtgcggcaacggcggcggcattgcccc Protospacer
. ****************** ** .
