Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LR735433 Staphylococcus epidermidis strain none isolate Se_RP62a-WT plasmid 2 0 crisprs NA 0 0 1 0
NZ_LR735432 Staphylococcus epidermidis strain none isolate Se_RP62a-WT chromosome 1 4 crisprs cas2,cas10,csm2gr11,csm3gr7,csm4gr5,csm5gr7,csm6,cas6,csa3,WYL,DEDDh,cas3,DinG 0 8 6 0

Results visualization

1. NZ_LR735433
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12497 : 21961 11 Streptococcus_phage(62.5%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_LR735432
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR735432_1 98464-98717 TypeIII NA
3 spacers
cas1,cas2,cas10,csm2gr11,csm3gr7,csm4gr5,csm5gr7,csm6,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR735432_2 624065-624147 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR735432_3 2137675-2137770 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LR735432_4 2369955-2370043 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NZ_CP026078 Staphylococcus aureus strain FDAARGOS_7 plasmid unnamed 26786-26819 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NZ_KU882682 Staphylococcus lugdunensis strain K93G plasmid pK93G, complete sequence 20645-20678 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NZ_KU882683 Staphylococcus lugdunensis strain Tlug33G-4 plasmid pT33G-1, complete sequence 5957-5990 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NZ_KT780704 Staphylococcus aureus subsp. aureus RN4220 plasmid pRM27, complete sequence 59139-59172 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NZ_KT780705 Staphylococcus aureus subsp. aureus RN4220 plasmid pGO400, complete sequence 29198-29231 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NZ_KT373969 Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence 46510-46543 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NZ_KU882681 Staphylococcus lugdunensis strain Tlug15G-4 plasmid pT15G-1, complete sequence 37224-37257 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030382 Staphylococcus aureus strain ER03761.3 plasmid unnamed1, complete sequence 19782-19815 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030491 Staphylococcus aureus strain ER02837.3 plasmid unnamed1, complete sequence 19782-19815 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030606 Staphylococcus aureus strain ER02693.3 plasmid unnamed1, complete sequence 1825-1858 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030388 Staphylococcus aureus strain ER01062.3 plasmid unnamed2, complete sequence 8235-8268 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NC_007792 Staphylococcus aureus subsp. aureus USA300_FPR3757 plasmid pUSA03, complete sequence 32206-32239 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030522 Staphylococcus aureus strain ER01564.3 plasmid unnamed2, complete sequence 7491-7524 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NC_005054 Staphylococcus aureus plasmid pLW043, complete sequence 52960-52993 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030554 Staphylococcus aureus strain PS00003.3 plasmid unnamed1, complete sequence 19782-19815 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030614 Staphylococcus aureus strain ER01560.3 plasmid unnamed1, complete sequence 27436-27469 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NC_013338 Staphylococcus aureus plasmid SAP068A, complete sequence 6137-6170 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030618 Staphylococcus aureus strain ER04440.3 plasmid unnamed1, complete sequence 19782-19815 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030671 Staphylococcus aureus strain ER00951.3 plasmid unnamed2, complete sequence 39246-39279 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NC_012547 Staphylococcus aureus plasmid pGO1, complete sequence 8175-8208 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030622 Staphylococcus aureus strain ER01524.3 plasmid unnamed2, complete sequence 23252-23285 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NC_005024 Staphylococcus aureus plasmid pSK41, complete sequence 8175-8208 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NC_013320 Staphylococcus aureus plasmid SAP014A, complete sequence 14264-14297 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NC_013339 Staphylococcus aureus plasmid SAP069A, complete sequence 26753-26786 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NC_013342 Staphylococcus aureus plasmid SAP079A, complete sequence 19627-19660 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NC_013343 Staphylococcus aureus plasmid SAP080A, complete sequence 34530-34563 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NC_013344 Staphylococcus aureus plasmid SAP082A, complete sequence 22786-22819 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030538 Staphylococcus aureus strain ER02094.3 plasmid unnamed2, complete sequence 41572-41605 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030556 Staphylococcus aureus strain ER03750.3 plasmid unnamed1, complete sequence 16791-16824 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030639 Staphylococcus aureus strain ER04165.3 plasmid unnamed1, complete sequence 19782-19815 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030435 Staphylococcus aureus strain ER00610.3 plasmid unnamed2, complete sequence 6861-6894 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030526 Staphylococcus aureus strain ER02703.3 plasmid unnamed1, complete sequence 6861-6894 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030677 Staphylococcus aureus strain ER01533.3 plasmid unnamed3, complete sequence 26222-26255 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030600 Staphylococcus aureus strain ER00658.3 plasmid unnamed1, complete sequence 4557-4590 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NZ_AP017321 Staphylococcus aureus strain MI plasmid pMI, complete sequence 25839-25872 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NZ_CP026963 Staphylococcus aureus strain FDAARGOS_6 plasmid unnamed1 11507-11540 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030429 Staphylococcus aureus strain ER03760.3 plasmid unnamed1, complete sequence 19783-19816 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030648 Staphylococcus aureus strain ER03556.3 plasmid unnamed1, complete sequence 19781-19814 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NC_020535 Staphylococcus aureus subsp. aureus ST228 plasmid pI5S5, complete sequence 32357-32390 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030407 Staphylococcus aureus strain PS00002.3 plasmid unnamed1, complete sequence 19780-19813 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030559 Staphylococcus aureus strain ER01457.3 plasmid unnamed1, complete sequence 29524-29557 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030678 Staphylococcus aureus strain ER00573.3 plasmid unnamed1, complete sequence 7917-7950 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NZ_CP040620 Staphylococcus aureus strain J01 plasmid pJ01-01, complete sequence 36681-36714 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NZ_MH587578 Staphylococcus aureus strain WG1647 plasmid pWBG615, complete sequence 38066-38099 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030591 Staphylococcus aureus strain ER02989.3 plasmid unnamed1, complete sequence 31911-31944 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP030453 Staphylococcus aureus strain PS00001.3 plasmid unnamed1, complete sequence 19779-19812 0 1.0
NZ_LR735432_1 1.2|98572|34|NZ_LR735432|CRISPRCasFinder 98572-98605 34 NC_008723 Staphylococcus phage PH15, complete genome 16870-16903 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NZ_KU882683 Staphylococcus lugdunensis strain Tlug33G-4 plasmid pT33G-1, complete sequence 5957-5991 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NC_013338 Staphylococcus aureus plasmid SAP068A, complete sequence 6137-6171 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030622 Staphylococcus aureus strain ER01524.3 plasmid unnamed2, complete sequence 23252-23286 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NC_013339 Staphylococcus aureus plasmid SAP069A, complete sequence 26753-26787 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NC_013344 Staphylococcus aureus plasmid SAP082A, complete sequence 22786-22820 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030538 Staphylococcus aureus strain ER02094.3 plasmid unnamed2, complete sequence 41572-41606 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030435 Staphylococcus aureus strain ER00610.3 plasmid unnamed2, complete sequence 6861-6895 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030526 Staphylococcus aureus strain ER02703.3 plasmid unnamed1, complete sequence 6861-6895 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NZ_CP026078 Staphylococcus aureus strain FDAARGOS_7 plasmid unnamed 26785-26819 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NZ_KU882682 Staphylococcus lugdunensis strain K93G plasmid pK93G, complete sequence 20644-20678 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NZ_KT780704 Staphylococcus aureus subsp. aureus RN4220 plasmid pRM27, complete sequence 59138-59172 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NZ_KT780705 Staphylococcus aureus subsp. aureus RN4220 plasmid pGO400, complete sequence 29197-29231 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NZ_KT373969 Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence 46509-46543 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NZ_KU882681 Staphylococcus lugdunensis strain Tlug15G-4 plasmid pT15G-1, complete sequence 37223-37257 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030382 Staphylococcus aureus strain ER03761.3 plasmid unnamed1, complete sequence 19781-19815 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030491 Staphylococcus aureus strain ER02837.3 plasmid unnamed1, complete sequence 19781-19815 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030606 Staphylococcus aureus strain ER02693.3 plasmid unnamed1, complete sequence 1824-1858 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030388 Staphylococcus aureus strain ER01062.3 plasmid unnamed2, complete sequence 8234-8268 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NC_007792 Staphylococcus aureus subsp. aureus USA300_FPR3757 plasmid pUSA03, complete sequence 32205-32239 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030522 Staphylococcus aureus strain ER01564.3 plasmid unnamed2, complete sequence 7490-7524 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NC_005054 Staphylococcus aureus plasmid pLW043, complete sequence 52959-52993 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030554 Staphylococcus aureus strain PS00003.3 plasmid unnamed1, complete sequence 19781-19815 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030614 Staphylococcus aureus strain ER01560.3 plasmid unnamed1, complete sequence 27435-27469 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030618 Staphylococcus aureus strain ER04440.3 plasmid unnamed1, complete sequence 19781-19815 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030671 Staphylococcus aureus strain ER00951.3 plasmid unnamed2, complete sequence 39245-39279 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NC_012547 Staphylococcus aureus plasmid pGO1, complete sequence 8174-8208 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NC_005024 Staphylococcus aureus plasmid pSK41, complete sequence 8174-8208 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NC_013320 Staphylococcus aureus plasmid SAP014A, complete sequence 14263-14297 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NC_013342 Staphylococcus aureus plasmid SAP079A, complete sequence 19626-19660 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NC_013343 Staphylococcus aureus plasmid SAP080A, complete sequence 34529-34563 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030556 Staphylococcus aureus strain ER03750.3 plasmid unnamed1, complete sequence 16790-16824 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030639 Staphylococcus aureus strain ER04165.3 plasmid unnamed1, complete sequence 19781-19815 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030677 Staphylococcus aureus strain ER01533.3 plasmid unnamed3, complete sequence 26221-26255 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030600 Staphylococcus aureus strain ER00658.3 plasmid unnamed1, complete sequence 4556-4590 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NZ_AP017321 Staphylococcus aureus strain MI plasmid pMI, complete sequence 25838-25872 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NZ_CP026963 Staphylococcus aureus strain FDAARGOS_6 plasmid unnamed1 11506-11540 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030429 Staphylococcus aureus strain ER03760.3 plasmid unnamed1, complete sequence 19782-19816 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030648 Staphylococcus aureus strain ER03556.3 plasmid unnamed1, complete sequence 19780-19814 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NC_020535 Staphylococcus aureus subsp. aureus ST228 plasmid pI5S5, complete sequence 32356-32390 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030407 Staphylococcus aureus strain PS00002.3 plasmid unnamed1, complete sequence 19779-19813 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030559 Staphylococcus aureus strain ER01457.3 plasmid unnamed1, complete sequence 29523-29557 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030678 Staphylococcus aureus strain ER00573.3 plasmid unnamed1, complete sequence 7916-7950 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NZ_CP040620 Staphylococcus aureus strain J01 plasmid pJ01-01, complete sequence 36680-36714 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NZ_MH587578 Staphylococcus aureus strain WG1647 plasmid pWBG615, complete sequence 38065-38099 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030591 Staphylococcus aureus strain ER02989.3 plasmid unnamed1, complete sequence 31910-31944 0 1.0
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP030453 Staphylococcus aureus strain PS00001.3 plasmid unnamed1, complete sequence 19778-19812 0 1.0
NZ_LR735432_1 1.5|98572|35|NZ_LR735432|PILER-CR 98572-98606 35 NC_008723 Staphylococcus phage PH15, complete genome 16869-16903 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NZ_CP026078 Staphylococcus aureus strain FDAARGOS_7 plasmid unnamed 26785-26814 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NZ_KU882682 Staphylococcus lugdunensis strain K93G plasmid pK93G, complete sequence 20644-20673 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NZ_KT780704 Staphylococcus aureus subsp. aureus RN4220 plasmid pRM27, complete sequence 59138-59167 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NZ_KT780705 Staphylococcus aureus subsp. aureus RN4220 plasmid pGO400, complete sequence 29197-29226 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NZ_KT373969 Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence 46509-46538 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NZ_KU882681 Staphylococcus lugdunensis strain Tlug15G-4 plasmid pT15G-1, complete sequence 37223-37252 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030382 Staphylococcus aureus strain ER03761.3 plasmid unnamed1, complete sequence 19781-19810 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030491 Staphylococcus aureus strain ER02837.3 plasmid unnamed1, complete sequence 19781-19810 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030606 Staphylococcus aureus strain ER02693.3 plasmid unnamed1, complete sequence 1824-1853 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030388 Staphylococcus aureus strain ER01062.3 plasmid unnamed2, complete sequence 8234-8263 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NC_007792 Staphylococcus aureus subsp. aureus USA300_FPR3757 plasmid pUSA03, complete sequence 32205-32234 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030522 Staphylococcus aureus strain ER01564.3 plasmid unnamed2, complete sequence 7490-7519 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NC_005054 Staphylococcus aureus plasmid pLW043, complete sequence 52959-52988 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030554 Staphylococcus aureus strain PS00003.3 plasmid unnamed1, complete sequence 19781-19810 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030614 Staphylococcus aureus strain ER01560.3 plasmid unnamed1, complete sequence 27435-27464 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030618 Staphylococcus aureus strain ER04440.3 plasmid unnamed1, complete sequence 19781-19810 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030671 Staphylococcus aureus strain ER00951.3 plasmid unnamed2, complete sequence 39245-39274 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NC_012547 Staphylococcus aureus plasmid pGO1, complete sequence 8174-8203 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NC_005024 Staphylococcus aureus plasmid pSK41, complete sequence 8174-8203 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NC_013320 Staphylococcus aureus plasmid SAP014A, complete sequence 14263-14292 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NC_013342 Staphylococcus aureus plasmid SAP079A, complete sequence 19626-19655 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NC_013343 Staphylococcus aureus plasmid SAP080A, complete sequence 34529-34558 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030556 Staphylococcus aureus strain ER03750.3 plasmid unnamed1, complete sequence 16790-16819 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030639 Staphylococcus aureus strain ER04165.3 plasmid unnamed1, complete sequence 19781-19810 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030677 Staphylococcus aureus strain ER01533.3 plasmid unnamed3, complete sequence 26221-26250 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030600 Staphylococcus aureus strain ER00658.3 plasmid unnamed1, complete sequence 4556-4585 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NZ_AP017321 Staphylococcus aureus strain MI plasmid pMI, complete sequence 25838-25867 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 AP012550 Staphylococcus aureus plasmid pN315G DNA, complete sequence, strain: N315G 8204-8233 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NZ_CP026963 Staphylococcus aureus strain FDAARGOS_6 plasmid unnamed1 11506-11535 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030429 Staphylococcus aureus strain ER03760.3 plasmid unnamed1, complete sequence 19782-19811 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030648 Staphylococcus aureus strain ER03556.3 plasmid unnamed1, complete sequence 19780-19809 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NC_020535 Staphylococcus aureus subsp. aureus ST228 plasmid pI5S5, complete sequence 32356-32385 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030407 Staphylococcus aureus strain PS00002.3 plasmid unnamed1, complete sequence 19779-19808 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030559 Staphylococcus aureus strain ER01457.3 plasmid unnamed1, complete sequence 29523-29552 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030678 Staphylococcus aureus strain ER00573.3 plasmid unnamed1, complete sequence 7916-7945 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NZ_CP040620 Staphylococcus aureus strain J01 plasmid pJ01-01, complete sequence 36680-36709 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NZ_MH587578 Staphylococcus aureus strain WG1647 plasmid pWBG615, complete sequence 38065-38094 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030591 Staphylococcus aureus strain ER02989.3 plasmid unnamed1, complete sequence 31910-31939 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030453 Staphylococcus aureus strain PS00001.3 plasmid unnamed1, complete sequence 19778-19807 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NZ_KU882683 Staphylococcus lugdunensis strain Tlug33G-4 plasmid pT33G-1, complete sequence 5962-5991 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NC_013338 Staphylococcus aureus plasmid SAP068A, complete sequence 6142-6171 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030622 Staphylococcus aureus strain ER01524.3 plasmid unnamed2, complete sequence 23257-23286 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NC_013339 Staphylococcus aureus plasmid SAP069A, complete sequence 26758-26787 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NC_013344 Staphylococcus aureus plasmid SAP082A, complete sequence 22791-22820 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030538 Staphylococcus aureus strain ER02094.3 plasmid unnamed2, complete sequence 41577-41606 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030435 Staphylococcus aureus strain ER00610.3 plasmid unnamed2, complete sequence 6866-6895 0 1.0
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP030526 Staphylococcus aureus strain ER02703.3 plasmid unnamed1, complete sequence 6866-6895 0 1.0
NZ_LR735432_1 1.7|98577|30|NZ_LR735432|CRT 98577-98606 30 NC_008723 Staphylococcus phage PH15, complete genome 16869-16898 0 1.0
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 AP012550 Staphylococcus aureus plasmid pN315G DNA, complete sequence, strain: N315G 8205-8238 1 0.971
NZ_LR735432_1 1.2|98572|34|NZ_LR735432|CRISPRCasFinder 98572-98605 34 KY653120 Staphylococcus phage IME1348_01, complete genome 31823-31856 1 0.971
NZ_LR735432_1 1.2|98572|34|NZ_LR735432|CRISPRCasFinder 98572-98605 34 JN192400 Staphylococcus phage vB_SepiS-phiIPLA5, complete genome 16169-16202 1 0.971
NZ_LR735432_1 1.2|98572|34|NZ_LR735432|CRISPRCasFinder 98572-98605 34 KU598975 Staphylococcus phage CNPx, complete genome 16223-16256 1 0.971
NZ_LR735432_1 1.2|98572|34|NZ_LR735432|CRISPRCasFinder 98572-98605 34 JN192401 Staphylococcus phage vB_SepiS-phiIPLA7, complete genome 15767-15800 1 0.971
NZ_LR735432_1 1.2|98572|34|NZ_LR735432|CRISPRCasFinder 98572-98605 34 DQ831957 Staphylococcus phage CNPH82, complete genome 16223-16256 1 0.971
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 AP012550 Staphylococcus aureus plasmid pN315G DNA, complete sequence, strain: N315G 8204-8238 1 0.971
NZ_LR735432_1 1.5|98572|35|NZ_LR735432|PILER-CR 98572-98606 35 KY653120 Staphylococcus phage IME1348_01, complete genome 31822-31856 1 0.971
NZ_LR735432_1 1.5|98572|35|NZ_LR735432|PILER-CR 98572-98606 35 JN192400 Staphylococcus phage vB_SepiS-phiIPLA5, complete genome 16168-16202 1 0.971
NZ_LR735432_1 1.5|98572|35|NZ_LR735432|PILER-CR 98572-98606 35 KU598975 Staphylococcus phage CNPx, complete genome 16222-16256 1 0.971
NZ_LR735432_1 1.5|98572|35|NZ_LR735432|PILER-CR 98572-98606 35 JN192401 Staphylococcus phage vB_SepiS-phiIPLA7, complete genome 15766-15800 1 0.971
NZ_LR735432_1 1.5|98572|35|NZ_LR735432|PILER-CR 98572-98606 35 DQ831957 Staphylococcus phage CNPH82, complete genome 16222-16256 1 0.971
NZ_LR735432_1 1.7|98577|30|NZ_LR735432|CRT 98577-98606 30 KY653120 Staphylococcus phage IME1348_01, complete genome 31822-31851 1 0.967
NZ_LR735432_1 1.7|98577|30|NZ_LR735432|CRT 98577-98606 30 JN192400 Staphylococcus phage vB_SepiS-phiIPLA5, complete genome 16168-16197 1 0.967
NZ_LR735432_1 1.7|98577|30|NZ_LR735432|CRT 98577-98606 30 KU598975 Staphylococcus phage CNPx, complete genome 16222-16251 1 0.967
NZ_LR735432_1 1.7|98577|30|NZ_LR735432|CRT 98577-98606 30 JN192401 Staphylococcus phage vB_SepiS-phiIPLA7, complete genome 15766-15795 1 0.967
NZ_LR735432_1 1.7|98577|30|NZ_LR735432|CRT 98577-98606 30 DQ831957 Staphylococcus phage CNPH82, complete genome 16222-16251 1 0.967
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NZ_KY465818 Staphylococcus aureus subsp. aureus strain CC1 plasmid p140355, complete sequence 23795-23828 2 0.941
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NC_013653 Staphylococcus aureus plasmid pPR9, complete sequence 18506-18539 2 0.941
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 CP013960 Staphylococcus aureus strain V605 plasmid pV605, complete sequence 1323-1356 2 0.941
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NC_010279 Staphylococcus aureus plasmid pV030-8, complete sequence 34108-34141 2 0.941
NZ_LR735432_1 1.1|98501|34|NZ_LR735432|CRISPRCasFinder 98501-98534 34 NC_018967 Staphylococcus aureus plasmid p18813-P03, complete sequence 25096-25129 2 0.941
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 CP013960 Staphylococcus aureus strain V605 plasmid pV605, complete sequence 1323-1357 2 0.943
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NZ_KY465818 Staphylococcus aureus subsp. aureus strain CC1 plasmid p140355, complete sequence 23794-23828 2 0.943
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NC_013653 Staphylococcus aureus plasmid pPR9, complete sequence 18505-18539 2 0.943
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NC_010279 Staphylococcus aureus plasmid pV030-8, complete sequence 34107-34141 2 0.943
NZ_LR735432_1 1.4|98501|35|NZ_LR735432|PILER-CR 98501-98535 35 NC_018967 Staphylococcus aureus plasmid p18813-P03, complete sequence 25095-25129 2 0.943
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NZ_KY465818 Staphylococcus aureus subsp. aureus strain CC1 plasmid p140355, complete sequence 23794-23823 2 0.933
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NC_013653 Staphylococcus aureus plasmid pPR9, complete sequence 18505-18534 2 0.933
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NC_010279 Staphylococcus aureus plasmid pV030-8, complete sequence 34107-34136 2 0.933
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 NC_018967 Staphylococcus aureus plasmid p18813-P03, complete sequence 25095-25124 2 0.933
NZ_LR735432_1 1.6|98506|30|NZ_LR735432|CRT 98506-98535 30 CP013960 Staphylococcus aureus strain V605 plasmid pV605, complete sequence 1328-1357 2 0.933
NZ_LR735432_3 3.1|2137708|30|NZ_LR735432|CRISPRCasFinder 2137708-2137737 30 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1051845-1051874 6 0.8
NZ_LR735432_1 1.8|98648|29|NZ_LR735432|CRT 98648-98676 29 KU878088 Bacillus phage AR9, complete genome 111273-111301 7 0.759
NZ_LR735432_1 1.8|98648|29|NZ_LR735432|CRT 98648-98676 29 MF360957 Bacillus virus PBS1, complete genome 21575-21603 7 0.759
NZ_LR735432_1 1.8|98648|29|NZ_LR735432|CRT 98648-98676 29 NZ_CP009417 Jeotgalibacillus malaysiensis strain malaysiensis plasmid unnamed, complete sequence 563600-563628 7 0.759

1. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NZ_CP026078 (Staphylococcus aureus strain FDAARGOS_7 plasmid unnamed) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

2. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NZ_KU882682 (Staphylococcus lugdunensis strain K93G plasmid pK93G, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

3. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NZ_KU882683 (Staphylococcus lugdunensis strain Tlug33G-4 plasmid pT33G-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

4. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NZ_KT780704 (Staphylococcus aureus subsp. aureus RN4220 plasmid pRM27, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

5. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NZ_KT780705 (Staphylococcus aureus subsp. aureus RN4220 plasmid pGO400, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

6. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NZ_KT373969 (Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

7. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NZ_KU882681 (Staphylococcus lugdunensis strain Tlug15G-4 plasmid pT15G-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

8. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030382 (Staphylococcus aureus strain ER03761.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

9. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030491 (Staphylococcus aureus strain ER02837.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

10. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030606 (Staphylococcus aureus strain ER02693.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

11. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030388 (Staphylococcus aureus strain ER01062.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

12. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NC_007792 (Staphylococcus aureus subsp. aureus USA300_FPR3757 plasmid pUSA03, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

13. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030522 (Staphylococcus aureus strain ER01564.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

14. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NC_005054 (Staphylococcus aureus plasmid pLW043, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

15. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030554 (Staphylococcus aureus strain PS00003.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

16. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030614 (Staphylococcus aureus strain ER01560.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

17. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NC_013338 (Staphylococcus aureus plasmid SAP068A, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

18. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030618 (Staphylococcus aureus strain ER04440.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

19. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030671 (Staphylococcus aureus strain ER00951.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

20. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NC_012547 (Staphylococcus aureus plasmid pGO1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

21. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030622 (Staphylococcus aureus strain ER01524.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

22. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NC_005024 (Staphylococcus aureus plasmid pSK41, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

23. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NC_013320 (Staphylococcus aureus plasmid SAP014A, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

24. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NC_013339 (Staphylococcus aureus plasmid SAP069A, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

25. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NC_013342 (Staphylococcus aureus plasmid SAP079A, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

26. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NC_013343 (Staphylococcus aureus plasmid SAP080A, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

27. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NC_013344 (Staphylococcus aureus plasmid SAP082A, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

28. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030538 (Staphylococcus aureus strain ER02094.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

29. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030556 (Staphylococcus aureus strain ER03750.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

30. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030639 (Staphylococcus aureus strain ER04165.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

31. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030435 (Staphylococcus aureus strain ER00610.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

32. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030526 (Staphylococcus aureus strain ER02703.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

33. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030677 (Staphylococcus aureus strain ER01533.3 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

34. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030600 (Staphylococcus aureus strain ER00658.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

35. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NZ_AP017321 (Staphylococcus aureus strain MI plasmid pMI, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

36. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NZ_CP026963 (Staphylococcus aureus strain FDAARGOS_6 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

37. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030429 (Staphylococcus aureus strain ER03760.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

38. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030648 (Staphylococcus aureus strain ER03556.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

39. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NC_020535 (Staphylococcus aureus subsp. aureus ST228 plasmid pI5S5, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

40. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030407 (Staphylococcus aureus strain PS00002.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

41. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030559 (Staphylococcus aureus strain ER01457.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

42. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030678 (Staphylococcus aureus strain ER00573.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

43. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NZ_CP040620 (Staphylococcus aureus strain J01 plasmid pJ01-01, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

44. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NZ_MH587578 (Staphylococcus aureus strain WG1647 plasmid pWBG615, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

45. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030591 (Staphylococcus aureus strain ER02989.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

46. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP030453 (Staphylococcus aureus strain PS00001.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaa	Protospacer
**********************************

47. spacer 1.2|98572|34|NZ_LR735432|CRISPRCasFinder matches to NC_008723 (Staphylococcus phage PH15, complete genome) position: , mismatch: 0, identity: 1.0

tagtaataattgtcatttgcatacgttacatcga	CRISPR spacer
tagtaataattgtcatttgcatacgttacatcga	Protospacer
**********************************

48. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NZ_KU882683 (Staphylococcus lugdunensis strain Tlug33G-4 plasmid pT33G-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

49. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NC_013338 (Staphylococcus aureus plasmid SAP068A, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

50. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030622 (Staphylococcus aureus strain ER01524.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

51. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NC_013339 (Staphylococcus aureus plasmid SAP069A, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

52. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NC_013344 (Staphylococcus aureus plasmid SAP082A, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

53. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030538 (Staphylococcus aureus strain ER02094.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

54. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030435 (Staphylococcus aureus strain ER00610.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

55. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030526 (Staphylococcus aureus strain ER02703.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

56. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NZ_CP026078 (Staphylococcus aureus strain FDAARGOS_7 plasmid unnamed) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

57. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NZ_KU882682 (Staphylococcus lugdunensis strain K93G plasmid pK93G, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

58. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NZ_KT780704 (Staphylococcus aureus subsp. aureus RN4220 plasmid pRM27, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

59. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NZ_KT780705 (Staphylococcus aureus subsp. aureus RN4220 plasmid pGO400, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

60. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NZ_KT373969 (Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

61. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NZ_KU882681 (Staphylococcus lugdunensis strain Tlug15G-4 plasmid pT15G-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

62. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030382 (Staphylococcus aureus strain ER03761.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

63. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030491 (Staphylococcus aureus strain ER02837.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

64. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030606 (Staphylococcus aureus strain ER02693.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

65. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030388 (Staphylococcus aureus strain ER01062.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

66. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NC_007792 (Staphylococcus aureus subsp. aureus USA300_FPR3757 plasmid pUSA03, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

67. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030522 (Staphylococcus aureus strain ER01564.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

68. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NC_005054 (Staphylococcus aureus plasmid pLW043, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

69. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030554 (Staphylococcus aureus strain PS00003.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

70. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030614 (Staphylococcus aureus strain ER01560.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

71. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030618 (Staphylococcus aureus strain ER04440.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

72. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030671 (Staphylococcus aureus strain ER00951.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

73. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NC_012547 (Staphylococcus aureus plasmid pGO1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

74. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NC_005024 (Staphylococcus aureus plasmid pSK41, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

75. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NC_013320 (Staphylococcus aureus plasmid SAP014A, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

76. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NC_013342 (Staphylococcus aureus plasmid SAP079A, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

77. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NC_013343 (Staphylococcus aureus plasmid SAP080A, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

78. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030556 (Staphylococcus aureus strain ER03750.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

79. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030639 (Staphylococcus aureus strain ER04165.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

80. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030677 (Staphylococcus aureus strain ER01533.3 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

81. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030600 (Staphylococcus aureus strain ER00658.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

82. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NZ_AP017321 (Staphylococcus aureus strain MI plasmid pMI, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

83. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NZ_CP026963 (Staphylococcus aureus strain FDAARGOS_6 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

84. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030429 (Staphylococcus aureus strain ER03760.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

85. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030648 (Staphylococcus aureus strain ER03556.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

86. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NC_020535 (Staphylococcus aureus subsp. aureus ST228 plasmid pI5S5, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

87. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030407 (Staphylococcus aureus strain PS00002.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

88. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030559 (Staphylococcus aureus strain ER01457.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

89. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030678 (Staphylococcus aureus strain ER00573.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

90. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NZ_CP040620 (Staphylococcus aureus strain J01 plasmid pJ01-01, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

91. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NZ_MH587578 (Staphylococcus aureus strain WG1647 plasmid pWBG615, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

92. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030591 (Staphylococcus aureus strain ER02989.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

93. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP030453 (Staphylococcus aureus strain PS00001.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgccgaagtatataaatcatcagtacaaag	Protospacer
***********************************

94. spacer 1.5|98572|35|NZ_LR735432|PILER-CR matches to NC_008723 (Staphylococcus phage PH15, complete genome) position: , mismatch: 0, identity: 1.0

tagtaataattgtcatttgcatacgttacatcgat	CRISPR spacer
tagtaataattgtcatttgcatacgttacatcgat	Protospacer
***********************************

95. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NZ_CP026078 (Staphylococcus aureus strain FDAARGOS_7 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

96. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NZ_KU882682 (Staphylococcus lugdunensis strain K93G plasmid pK93G, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

97. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NZ_KT780704 (Staphylococcus aureus subsp. aureus RN4220 plasmid pRM27, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

98. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NZ_KT780705 (Staphylococcus aureus subsp. aureus RN4220 plasmid pGO400, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

99. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NZ_KT373969 (Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

100. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NZ_KU882681 (Staphylococcus lugdunensis strain Tlug15G-4 plasmid pT15G-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

101. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030382 (Staphylococcus aureus strain ER03761.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

102. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030491 (Staphylococcus aureus strain ER02837.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

103. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030606 (Staphylococcus aureus strain ER02693.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

104. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030388 (Staphylococcus aureus strain ER01062.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

105. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NC_007792 (Staphylococcus aureus subsp. aureus USA300_FPR3757 plasmid pUSA03, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

106. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030522 (Staphylococcus aureus strain ER01564.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

107. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NC_005054 (Staphylococcus aureus plasmid pLW043, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

108. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030554 (Staphylococcus aureus strain PS00003.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

109. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030614 (Staphylococcus aureus strain ER01560.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

110. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030618 (Staphylococcus aureus strain ER04440.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

111. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030671 (Staphylococcus aureus strain ER00951.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

112. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NC_012547 (Staphylococcus aureus plasmid pGO1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

113. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NC_005024 (Staphylococcus aureus plasmid pSK41, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

114. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NC_013320 (Staphylococcus aureus plasmid SAP014A, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

115. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NC_013342 (Staphylococcus aureus plasmid SAP079A, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

116. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NC_013343 (Staphylococcus aureus plasmid SAP080A, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

117. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030556 (Staphylococcus aureus strain ER03750.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

118. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030639 (Staphylococcus aureus strain ER04165.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

119. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030677 (Staphylococcus aureus strain ER01533.3 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

120. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030600 (Staphylococcus aureus strain ER00658.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

121. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NZ_AP017321 (Staphylococcus aureus strain MI plasmid pMI, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

122. spacer 1.6|98506|30|NZ_LR735432|CRT matches to AP012550 (Staphylococcus aureus plasmid pN315G DNA, complete sequence, strain: N315G) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

123. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NZ_CP026963 (Staphylococcus aureus strain FDAARGOS_6 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

124. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030429 (Staphylococcus aureus strain ER03760.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

125. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030648 (Staphylococcus aureus strain ER03556.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

126. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NC_020535 (Staphylococcus aureus subsp. aureus ST228 plasmid pI5S5, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

127. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030407 (Staphylococcus aureus strain PS00002.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

128. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030559 (Staphylococcus aureus strain ER01457.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

129. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030678 (Staphylococcus aureus strain ER00573.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

130. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NZ_CP040620 (Staphylococcus aureus strain J01 plasmid pJ01-01, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

131. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NZ_MH587578 (Staphylococcus aureus strain WG1647 plasmid pWBG615, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

132. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030591 (Staphylococcus aureus strain ER02989.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

133. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030453 (Staphylococcus aureus strain PS00001.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

134. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NZ_KU882683 (Staphylococcus lugdunensis strain Tlug33G-4 plasmid pT33G-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

135. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NC_013338 (Staphylococcus aureus plasmid SAP068A, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

136. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030622 (Staphylococcus aureus strain ER01524.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

137. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NC_013339 (Staphylococcus aureus plasmid SAP069A, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

138. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NC_013344 (Staphylococcus aureus plasmid SAP082A, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

139. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030538 (Staphylococcus aureus strain ER02094.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

140. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030435 (Staphylococcus aureus strain ER00610.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

141. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP030526 (Staphylococcus aureus strain ER02703.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgccgaagtatataaatcatcagtacaaag	Protospacer
******************************

142. spacer 1.7|98577|30|NZ_LR735432|CRT matches to NC_008723 (Staphylococcus phage PH15, complete genome) position: , mismatch: 0, identity: 1.0

ataattgtcatttgcatacgttacatcgat	CRISPR spacer
ataattgtcatttgcatacgttacatcgat	Protospacer
******************************

143. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to AP012550 (Staphylococcus aureus plasmid pN315G DNA, complete sequence, strain: N315G) position: , mismatch: 1, identity: 0.971

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
tcgtatgccgaagtatataaatcatcagtacaaa	Protospacer
 *********************************

144. spacer 1.2|98572|34|NZ_LR735432|CRISPRCasFinder matches to KY653120 (Staphylococcus phage IME1348_01, complete genome) position: , mismatch: 1, identity: 0.971

tagtaataattgtcatttgcatacgttacatcga	CRISPR spacer
tagtaataattgtcatttgcatatgttacatcga	Protospacer
***********************.**********

145. spacer 1.2|98572|34|NZ_LR735432|CRISPRCasFinder matches to JN192400 (Staphylococcus phage vB_SepiS-phiIPLA5, complete genome) position: , mismatch: 1, identity: 0.971

tagtaataattgtcatttgcatacgttacatcga	CRISPR spacer
tagtaataattgtcatttgcatatgttacatcga	Protospacer
***********************.**********

146. spacer 1.2|98572|34|NZ_LR735432|CRISPRCasFinder matches to KU598975 (Staphylococcus phage CNPx, complete genome) position: , mismatch: 1, identity: 0.971

tagtaataattgtcatttgcatacgttacatcga	CRISPR spacer
tagtaataattgtcatttgcatatgttacatcga	Protospacer
***********************.**********

147. spacer 1.2|98572|34|NZ_LR735432|CRISPRCasFinder matches to JN192401 (Staphylococcus phage vB_SepiS-phiIPLA7, complete genome) position: , mismatch: 1, identity: 0.971

tagtaataattgtcatttgcatacgttacatcga	CRISPR spacer
tagtaataattgtcatttgcatatgttacatcga	Protospacer
***********************.**********

148. spacer 1.2|98572|34|NZ_LR735432|CRISPRCasFinder matches to DQ831957 (Staphylococcus phage CNPH82, complete genome) position: , mismatch: 1, identity: 0.971

tagtaataattgtcatttgcatacgttacatcga	CRISPR spacer
tagtaataattgtcatttgcatatgttacatcga	Protospacer
***********************.**********

149. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to AP012550 (Staphylococcus aureus plasmid pN315G DNA, complete sequence, strain: N315G) position: , mismatch: 1, identity: 0.971

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tcgtatgccgaagtatataaatcatcagtacaaag	Protospacer
 **********************************

150. spacer 1.5|98572|35|NZ_LR735432|PILER-CR matches to KY653120 (Staphylococcus phage IME1348_01, complete genome) position: , mismatch: 1, identity: 0.971

tagtaataattgtcatttgcatacgttacatcgat	CRISPR spacer
tagtaataattgtcatttgcatatgttacatcgat	Protospacer
***********************.***********

151. spacer 1.5|98572|35|NZ_LR735432|PILER-CR matches to JN192400 (Staphylococcus phage vB_SepiS-phiIPLA5, complete genome) position: , mismatch: 1, identity: 0.971

tagtaataattgtcatttgcatacgttacatcgat	CRISPR spacer
tagtaataattgtcatttgcatatgttacatcgat	Protospacer
***********************.***********

152. spacer 1.5|98572|35|NZ_LR735432|PILER-CR matches to KU598975 (Staphylococcus phage CNPx, complete genome) position: , mismatch: 1, identity: 0.971

tagtaataattgtcatttgcatacgttacatcgat	CRISPR spacer
tagtaataattgtcatttgcatatgttacatcgat	Protospacer
***********************.***********

153. spacer 1.5|98572|35|NZ_LR735432|PILER-CR matches to JN192401 (Staphylococcus phage vB_SepiS-phiIPLA7, complete genome) position: , mismatch: 1, identity: 0.971

tagtaataattgtcatttgcatacgttacatcgat	CRISPR spacer
tagtaataattgtcatttgcatatgttacatcgat	Protospacer
***********************.***********

154. spacer 1.5|98572|35|NZ_LR735432|PILER-CR matches to DQ831957 (Staphylococcus phage CNPH82, complete genome) position: , mismatch: 1, identity: 0.971

tagtaataattgtcatttgcatacgttacatcgat	CRISPR spacer
tagtaataattgtcatttgcatatgttacatcgat	Protospacer
***********************.***********

155. spacer 1.7|98577|30|NZ_LR735432|CRT matches to KY653120 (Staphylococcus phage IME1348_01, complete genome) position: , mismatch: 1, identity: 0.967

ataattgtcatttgcatacgttacatcgat	CRISPR spacer
ataattgtcatttgcatatgttacatcgat	Protospacer
******************.***********

156. spacer 1.7|98577|30|NZ_LR735432|CRT matches to JN192400 (Staphylococcus phage vB_SepiS-phiIPLA5, complete genome) position: , mismatch: 1, identity: 0.967

ataattgtcatttgcatacgttacatcgat	CRISPR spacer
ataattgtcatttgcatatgttacatcgat	Protospacer
******************.***********

157. spacer 1.7|98577|30|NZ_LR735432|CRT matches to KU598975 (Staphylococcus phage CNPx, complete genome) position: , mismatch: 1, identity: 0.967

ataattgtcatttgcatacgttacatcgat	CRISPR spacer
ataattgtcatttgcatatgttacatcgat	Protospacer
******************.***********

158. spacer 1.7|98577|30|NZ_LR735432|CRT matches to JN192401 (Staphylococcus phage vB_SepiS-phiIPLA7, complete genome) position: , mismatch: 1, identity: 0.967

ataattgtcatttgcatacgttacatcgat	CRISPR spacer
ataattgtcatttgcatatgttacatcgat	Protospacer
******************.***********

159. spacer 1.7|98577|30|NZ_LR735432|CRT matches to DQ831957 (Staphylococcus phage CNPH82, complete genome) position: , mismatch: 1, identity: 0.967

ataattgtcatttgcatacgttacatcgat	CRISPR spacer
ataattgtcatttgcatatgttacatcgat	Protospacer
******************.***********

160. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NZ_KY465818 (Staphylococcus aureus subsp. aureus strain CC1 plasmid p140355, complete sequence) position: , mismatch: 2, identity: 0.941

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgcctaaatatataaatcatcagtacaaa	Protospacer
********* **.*********************

161. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NC_013653 (Staphylococcus aureus plasmid pPR9, complete sequence) position: , mismatch: 2, identity: 0.941

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgcctaaatatataaatcatcagtacaaa	Protospacer
********* **.*********************

162. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to CP013960 (Staphylococcus aureus strain V605 plasmid pV605, complete sequence) position: , mismatch: 2, identity: 0.941

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgcctaaatatataaatcatcagtacaaa	Protospacer
********* **.*********************

163. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NC_010279 (Staphylococcus aureus plasmid pV030-8, complete sequence) position: , mismatch: 2, identity: 0.941

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgcctaaatatataaatcatcagtacaaa	Protospacer
********* **.*********************

164. spacer 1.1|98501|34|NZ_LR735432|CRISPRCasFinder matches to NC_018967 (Staphylococcus aureus plasmid p18813-P03, complete sequence) position: , mismatch: 2, identity: 0.941

acgtatgccgaagtatataaatcatcagtacaaa	CRISPR spacer
acgtatgcctaaatatataaatcatcagtacaaa	Protospacer
********* **.*********************

165. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to CP013960 (Staphylococcus aureus strain V605 plasmid pV605, complete sequence) position: , mismatch: 2, identity: 0.943

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgcctaaatatataaatcatcagtacaaag	Protospacer
********* **.**********************

166. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NZ_KY465818 (Staphylococcus aureus subsp. aureus strain CC1 plasmid p140355, complete sequence) position: , mismatch: 2, identity: 0.943

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgcctaaatatataaatcatcagtacaaag	Protospacer
********* **.**********************

167. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NC_013653 (Staphylococcus aureus plasmid pPR9, complete sequence) position: , mismatch: 2, identity: 0.943

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgcctaaatatataaatcatcagtacaaag	Protospacer
********* **.**********************

168. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NC_010279 (Staphylococcus aureus plasmid pV030-8, complete sequence) position: , mismatch: 2, identity: 0.943

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgcctaaatatataaatcatcagtacaaag	Protospacer
********* **.**********************

169. spacer 1.4|98501|35|NZ_LR735432|PILER-CR matches to NC_018967 (Staphylococcus aureus plasmid p18813-P03, complete sequence) position: , mismatch: 2, identity: 0.943

acgtatgccgaagtatataaatcatcagtacaaag	CRISPR spacer
acgtatgcctaaatatataaatcatcagtacaaag	Protospacer
********* **.**********************

170. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NZ_KY465818 (Staphylococcus aureus subsp. aureus strain CC1 plasmid p140355, complete sequence) position: , mismatch: 2, identity: 0.933

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgcctaaatatataaatcatcagtacaaag	Protospacer
**** **.**********************

171. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NC_013653 (Staphylococcus aureus plasmid pPR9, complete sequence) position: , mismatch: 2, identity: 0.933

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgcctaaatatataaatcatcagtacaaag	Protospacer
**** **.**********************

172. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NC_010279 (Staphylococcus aureus plasmid pV030-8, complete sequence) position: , mismatch: 2, identity: 0.933

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgcctaaatatataaatcatcagtacaaag	Protospacer
**** **.**********************

173. spacer 1.6|98506|30|NZ_LR735432|CRT matches to NC_018967 (Staphylococcus aureus plasmid p18813-P03, complete sequence) position: , mismatch: 2, identity: 0.933

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgcctaaatatataaatcatcagtacaaag	Protospacer
**** **.**********************

174. spacer 1.6|98506|30|NZ_LR735432|CRT matches to CP013960 (Staphylococcus aureus strain V605 plasmid pV605, complete sequence) position: , mismatch: 2, identity: 0.933

tgccgaagtatataaatcatcagtacaaag	CRISPR spacer
tgcctaaatatataaatcatcagtacaaag	Protospacer
**** **.**********************

175. spacer 3.1|2137708|30|NZ_LR735432|CRISPRCasFinder matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8

cttgagctttgctcaggcgttcctcttttt	CRISPR spacer
tttgctttttgctcaggcgttcctgttgtt	Protospacer
.***  .***************** ** **

176. spacer 1.8|98648|29|NZ_LR735432|CRT matches to KU878088 (Bacillus phage AR9, complete genome) position: , mismatch: 7, identity: 0.759

cggtcgtg---aacattttttcttgattctct	CRISPR spacer
---tcacatataaaattttttcttgattctct	Protospacer
   **...   ** ******************

177. spacer 1.8|98648|29|NZ_LR735432|CRT matches to MF360957 (Bacillus virus PBS1, complete genome) position: , mismatch: 7, identity: 0.759

cggtcgtg---aacattttttcttgattctct	CRISPR spacer
---tcacatataaaattttttcttgattctct	Protospacer
   **...   ** ******************

178. spacer 1.8|98648|29|NZ_LR735432|CRT matches to NZ_CP009417 (Jeotgalibacillus malaysiensis strain malaysiensis plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

cggtcgtgaacattttttcttgattctct	CRISPR spacer
cttgtctcaacattttttcttgattgtct	Protospacer
*   . * ***************** ***

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 919773 : 1052668 147 Staphylococcus_phage(97.22%) transposase,holin,integrase,terminase,tail attL 979936:979955|attR 1023688:1023707
DBSCAN-SWA_2 1197104 : 1211805 15 Staphylococcus_phage(71.43%) integrase attL 1195573:1195588|attR 1200237:1200252
DBSCAN-SWA_3 1217233 : 1252032 25 Staphylococcus_phage(89.47%) tRNA NA
DBSCAN-SWA_4 1964958 : 1973428 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 2213001 : 2223436 10 uncultured_Caudovirales_phage(66.67%) NA NA
DBSCAN-SWA_6 2244859 : 2256727 14 Staphylococcus_phage(30.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage