Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Signature genes Anti-CRISPR protein number Self targeting spacer_number Prophage number
CP009676 Staphylococcus schleiferi strain 5909-02, complete genome 1 CRISPR WYL,DEDDh,cas3,DinG,cas2,cas1,cas9,csa3,TnsC,TnsB,casR 6 6 9

Results visualization

1. CP009676
Click the left colored region to show detailed information
Acr_ID Acr_info Acr size Homology with known anti Neighbor Aca In prophage ST in prophage Neighbor HTH Preidct by AcRanker
Acr_1 CP009676.1|AKS70260.1|1481214_1481610_+|hypothetical-protein 131 aa AcrIIA13 Aca8 1440739-1481610 NA NA No
Click the colored protein region to show detailed information
Acr_ID Acr_info Acr size Homology with known anti Neighbor Aca In prophage ST in prophage Neighbor HTH Preidct by AcRanker
Acr_2 CP009676.1|AKS70277.1|2008559_2008946_-|hypothetical-protein 128 aa AcrIIA13 Aca8 2007392-2054126 yes NA No
Click the colored protein region to show detailed information
Acr_ID Acr_info Acr size Homology with known anti Neighbor Aca In prophage ST in prophage Neighbor HTH Preidct by AcRanker
Acr_3 CP009676.1|AKS69308.1|1478826_1479600_+|hypothetical-protein 257 aa NA Aca8 1440739-1481610 NA NA No
Click the colored protein region to show detailed information
Acr_ID Acr_info Acr size Homology with known anti Neighbor Aca In prophage ST in prophage Neighbor HTH Preidct by AcRanker
Acr_4 CP009676.1|AKS69309.1|1479605_1480334_+|hypothetical-protein 242 aa NA Aca8 1440739-1481610 NA NA No
Click the colored protein region to show detailed information
Acr_ID Acr_info Acr size Homology with known anti Neighbor Aca In prophage ST in prophage Neighbor HTH Preidct by AcRanker
Acr_5 CP009676.1|AKS69747.1|2011791_2012187_-|phi-ETA-orf-63-like-protein 131 aa NA Aca8 2007392-2054126 yes NA No
Click the colored protein region to show detailed information
Acr_ID Acr_info Acr size Homology with known anti Neighbor Aca In prophage ST in prophage Neighbor HTH Preidct by AcRanker
Acr_6 CP009676.1|AKS69787.1|2045865_2046126_-|hypothetical-protein 86 aa NA NA 2007392-2054126 yes NA AcRanker
Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas protein info CRISPR-Cas info
CP009676_1 1544989-1546080 orTypeII NA
16 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
Crispr_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP009676_1 1.9|1545553|30|CP009676|CRISPRCasFinder,CRT,PILER-CR 1545553-1545582 30 CP009676.1 2019993-2020022 0 1.0
CP009676_1 1.12|1545751|30|CP009676|CRISPRCasFinder,CRT,PILER-CR 1545751-1545780 30 CP009676.1 2032867-2032896 0 1.0
CP009676_1 1.14|1545883|30|CP009676|CRISPRCasFinder,CRT,PILER-CR 1545883-1545912 30 CP009676.1 2047070-2047099 0 1.0
CP009676_1 1.16|1546015|30|CP009676|CRISPRCasFinder,CRT,PILER-CR 1546015-1546044 30 CP009676.1 2036492-2036521 0 1.0
CP009676_1 1.2|1545091|30|CP009676|CRISPRCasFinder,CRT,PILER-CR 1545091-1545120 30 CP009676.1 2010031-2010060 1 0.967
CP009676_1 1.13|1545817|30|CP009676|CRISPRCasFinder,CRT,PILER-CR 1545817-1545846 30 CP009676.1 2017992-2018021 1 0.967

1. spacer 1.9|1545553|30|CP009676|CRISPRCasFinder,CRT,PILER-CR matches to position: 2019993-2020022, mismatch: 0, identity: 1.0

atcagttgcctcctttgttatcgtaaaaca	CRISPR spacer
atcagttgcctcctttgttatcgtaaaaca	Protospacer
******************************

2. spacer 1.12|1545751|30|CP009676|CRISPRCasFinder,CRT,PILER-CR matches to position: 2032867-2032896, mismatch: 0, identity: 1.0

tagtttttttatggtctgtaatcaacctta	CRISPR spacer
tagtttttttatggtctgtaatcaacctta	Protospacer
******************************

3. spacer 1.14|1545883|30|CP009676|CRISPRCasFinder,CRT,PILER-CR matches to position: 2047070-2047099, mismatch: 0, identity: 1.0

aatggcttacattaacaaattcaacgaaat	CRISPR spacer
aatggcttacattaacaaattcaacgaaat	Protospacer
******************************

4. spacer 1.16|1546015|30|CP009676|CRISPRCasFinder,CRT,PILER-CR matches to position: 2036492-2036521, mismatch: 0, identity: 1.0

gtgtaactcctacttgattcgcaacactca	CRISPR spacer
gtgtaactcctacttgattcgcaacactca	Protospacer
******************************

5. spacer 1.2|1545091|30|CP009676|CRISPRCasFinder,CRT,PILER-CR matches to position: 2010031-2010060, mismatch: 1, identity: 0.967

accagccaccaggttggaacagatacccta	CRISPR spacer
accaaccaccaggttggaacagatacccta	Protospacer
****.*************************

6. spacer 1.13|1545817|30|CP009676|CRISPRCasFinder,CRT,PILER-CR matches to position: 2017992-2018021, mismatch: 1, identity: 0.967

gtggaattgtagcaatcttattaggtcttg	CRISPR spacer
gtgcaattgtagcaatcttattaggtcttg	Protospacer
*** **************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1058250 : 1081837 26 Staphylococcus_phage(90.0%) NA NA
DBSCAN-SWA_2 1085656 : 1093043 6 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_3 1207390 : 1218724 8 uncultured_Mediterranean_phage(57.14%) tRNA NA
DBSCAN-SWA_4 1351084 : 1360079 9 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_5 1440739 : 1481610 52 Staphylococcus_phage(82.0%) terminase,capsid,holin,tail,head,portal NA
DBSCAN-SWA_6 1590474 : 1648121 52 Streptococcus_phage(15.38%) transposase,protease,tRNA NA
DBSCAN-SWA_7 1830083 : 1838503 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_8 2007392 : 2054126 60 Staphylococcus_phage(53.7%) protease,terminase,integrase,capsid,tail,head,portal attL 2029393:2029407|attR 2051424:2051438
DBSCAN-SWA_9 2129578 : 2139288 7 uncultured_Caudovirales_phage(33.33%) NA NA